Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638625_at:

>probe:Drosophila_2:1638625_at:41:303; Interrogation_Position=100; Antisense; CCGTTGTTTAATTGTGCAACTACAA
>probe:Drosophila_2:1638625_at:461:349; Interrogation_Position=142; Antisense; GCAGTAGCAGCGGAGTCTCAGCAAT
>probe:Drosophila_2:1638625_at:53:291; Interrogation_Position=152; Antisense; CGGAGTCTCAGCAATTGGCACAATT
>probe:Drosophila_2:1638625_at:228:3; Interrogation_Position=165; Antisense; ATTGGCACAATTGGCGATAAATCAG
>probe:Drosophila_2:1638625_at:562:3; Interrogation_Position=174; Antisense; ATTGGCGATAAATCAGCAGCAAAAG
>probe:Drosophila_2:1638625_at:620:509; Interrogation_Position=18; Antisense; GTGCACAATGTGGAAATCCGTGTTC
>probe:Drosophila_2:1638625_at:495:113; Interrogation_Position=215; Antisense; AGCAGGCGAAGCAGTGTGAACTTTA
>probe:Drosophila_2:1638625_at:308:47; Interrogation_Position=33; Antisense; ATCCGTGTTCGGATTCAGGGTCAGG
>probe:Drosophila_2:1638625_at:305:715; Interrogation_Position=40; Antisense; TTCGGATTCAGGGTCAGGGTTCCCT
>probe:Drosophila_2:1638625_at:36:371; Interrogation_Position=52; Antisense; GTCAGGGTTCCCTTTGTAGTTGCCT
>probe:Drosophila_2:1638625_at:58:687; Interrogation_Position=64; Antisense; TTTGTAGTTGCCTCCTCCAAATGCG
>probe:Drosophila_2:1638625_at:305:93; Interrogation_Position=69; Antisense; AGTTGCCTCCTCCAAATGCGGAGCT
>probe:Drosophila_2:1638625_at:434:117; Interrogation_Position=90; Antisense; AGCTCCACTCCCGTTGTTTAATTGT
>probe:Drosophila_2:1638625_at:126:303; Interrogation_Position=94; Antisense; CCACTCCCGTTGTTTAATTGTGCAA

Paste this into a BLAST search page for me
CCGTTGTTTAATTGTGCAACTACAAGCAGTAGCAGCGGAGTCTCAGCAATCGGAGTCTCAGCAATTGGCACAATTATTGGCACAATTGGCGATAAATCAGATTGGCGATAAATCAGCAGCAAAAGGTGCACAATGTGGAAATCCGTGTTCAGCAGGCGAAGCAGTGTGAACTTTAATCCGTGTTCGGATTCAGGGTCAGGTTCGGATTCAGGGTCAGGGTTCCCTGTCAGGGTTCCCTTTGTAGTTGCCTTTTGTAGTTGCCTCCTCCAAATGCGAGTTGCCTCCTCCAAATGCGGAGCTAGCTCCACTCCCGTTGTTTAATTGTCCACTCCCGTTGTTTAATTGTGCAA

Full Affymetrix probeset data:

Annotations for 1638625_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime