Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638626_a_at:

>probe:Drosophila_2:1638626_a_at:369:335; Interrogation_Position=344; Antisense; GCTGCGCTACGCTAACATGATGATG
>probe:Drosophila_2:1638626_a_at:604:159; Interrogation_Position=376; Antisense; ACAATAAGCGTATGCGCTGTGCCGC
>probe:Drosophila_2:1638626_a_at:156:673; Interrogation_Position=498; Antisense; TACGCTGATCCGTCAACAATGATAG
>probe:Drosophila_2:1638626_a_at:11:27; Interrogation_Position=519; Antisense; ATAGCATGTCCTGGGCTTTGTGAGC
>probe:Drosophila_2:1638626_a_at:501:65; Interrogation_Position=559; Antisense; ATGGACCAAATGCTGTTGCCAGGCC
>probe:Drosophila_2:1638626_a_at:232:347; Interrogation_Position=616; Antisense; GCATCCTGTCGCGTGTGGCTTATAA
>probe:Drosophila_2:1638626_a_at:325:521; Interrogation_Position=630; Antisense; GTGGCTTATAAGTATTTCCTGGCAA
>probe:Drosophila_2:1638626_a_at:306:287; Interrogation_Position=648; Antisense; CTGGCAAGTGTTTCGATCGGATCCT
>probe:Drosophila_2:1638626_a_at:468:41; Interrogation_Position=663; Antisense; ATCGGATCCTGATATGGGCCACTTC
>probe:Drosophila_2:1638626_a_at:454:721; Interrogation_Position=685; Antisense; TTCCTTGGCGGGACATGTTGTCGTT
>probe:Drosophila_2:1638626_a_at:479:15; Interrogation_Position=759; Antisense; ATTTAGCCAGCTGCGGAATACCCAT
>probe:Drosophila_2:1638626_a_at:299:567; Interrogation_Position=793; Antisense; GGCTCGAAGCTATTTGGGAACCCAT
>probe:Drosophila_2:1638626_a_at:285:527; Interrogation_Position=808; Antisense; GGGAACCCATGTGCAATTCGTCAGA
>probe:Drosophila_2:1638626_a_at:698:589; Interrogation_Position=863; Antisense; TGGTATCTGGAATCTATTTGGCATT

Paste this into a BLAST search page for me
GCTGCGCTACGCTAACATGATGATGACAATAAGCGTATGCGCTGTGCCGCTACGCTGATCCGTCAACAATGATAGATAGCATGTCCTGGGCTTTGTGAGCATGGACCAAATGCTGTTGCCAGGCCGCATCCTGTCGCGTGTGGCTTATAAGTGGCTTATAAGTATTTCCTGGCAACTGGCAAGTGTTTCGATCGGATCCTATCGGATCCTGATATGGGCCACTTCTTCCTTGGCGGGACATGTTGTCGTTATTTAGCCAGCTGCGGAATACCCATGGCTCGAAGCTATTTGGGAACCCATGGGAACCCATGTGCAATTCGTCAGATGGTATCTGGAATCTATTTGGCATT

Full Affymetrix probeset data:

Annotations for 1638626_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime