FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638628_at:

>probe:Drosophila_2:1638628_at:581:111; Interrogation_Position=215; Antisense; AGCAACATCTGACACCCACGGCAGC
>probe:Drosophila_2:1638628_at:492:113; Interrogation_Position=257; Antisense; AGCAGCATGAGGAGCAAATCGACTT
>probe:Drosophila_2:1638628_at:132:553; Interrogation_Position=267; Antisense; GGAGCAAATCGACTTGCTGTCCACT
>probe:Drosophila_2:1638628_at:576:357; Interrogation_Position=270; Antisense; GCAAATCGACTTGCTGTCCACTCAA
>probe:Drosophila_2:1638628_at:406:43; Interrogation_Position=274; Antisense; ATCGACTTGCTGTCCACTCAACCAA
>probe:Drosophila_2:1638628_at:113:193; Interrogation_Position=297; Antisense; AACTCAGCCCGGCTTTTCCAGGAGA
>probe:Drosophila_2:1638628_at:113:649; Interrogation_Position=300; Antisense; TCAGCCCGGCTTTTCCAGGAGATTG
>probe:Drosophila_2:1638628_at:48:583; Interrogation_Position=323; Antisense; TGGCCCACAGCCAGGCAGTGAACCT
>probe:Drosophila_2:1638628_at:661:155; Interrogation_Position=329; Antisense; ACAGCCAGGCAGTGAACCTCAAGTT
>probe:Drosophila_2:1638628_at:422:379; Interrogation_Position=342; Antisense; GAACCTCAAGTTCAATAAGCTGATT
>probe:Drosophila_2:1638628_at:548:351; Interrogation_Position=66; Antisense; GCAGCAACACTTGAAGTACCAGCAA
>probe:Drosophila_2:1638628_at:475:187; Interrogation_Position=71; Antisense; AACACTTGAAGTACCAGCAATTGCA
>probe:Drosophila_2:1638628_at:570:487; Interrogation_Position=81; Antisense; GTACCAGCAATTGCAATACCAAATG
>probe:Drosophila_2:1638628_at:225:363; Interrogation_Position=93; Antisense; GCAATACCAAATGCAGCAGCAATAT

Paste this into a BLAST search page for me
AGCAACATCTGACACCCACGGCAGCAGCAGCATGAGGAGCAAATCGACTTGGAGCAAATCGACTTGCTGTCCACTGCAAATCGACTTGCTGTCCACTCAAATCGACTTGCTGTCCACTCAACCAAAACTCAGCCCGGCTTTTCCAGGAGATCAGCCCGGCTTTTCCAGGAGATTGTGGCCCACAGCCAGGCAGTGAACCTACAGCCAGGCAGTGAACCTCAAGTTGAACCTCAAGTTCAATAAGCTGATTGCAGCAACACTTGAAGTACCAGCAAAACACTTGAAGTACCAGCAATTGCAGTACCAGCAATTGCAATACCAAATGGCAATACCAAATGCAGCAGCAATAT

Full Affymetrix probeset data:

Annotations for 1638628_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720