FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638629_at:

>probe:Drosophila_2:1638629_at:423:225; Interrogation_Position=1054; Antisense; AAGGACTGTCCCGATTTGCCGGAGG
>probe:Drosophila_2:1638629_at:301:499; Interrogation_Position=1093; Antisense; GTCCAGTGCCACGTCCAAAAGATGT
>probe:Drosophila_2:1638629_at:493:573; Interrogation_Position=1123; Antisense; GGCGAGGAGCGCTACATGACCGTAT
>probe:Drosophila_2:1638629_at:495:55; Interrogation_Position=1138; Antisense; ATGACCGTATGCGACAAGTGCCCGT
>probe:Drosophila_2:1638629_at:724:585; Interrogation_Position=1178; Antisense; TGGACAATCCTCTGGGTCAGCAGCT
>probe:Drosophila_2:1638629_at:407:217; Interrogation_Position=640; Antisense; AAGTTCAAGGATCCGGCCATGTGGC
>probe:Drosophila_2:1638629_at:286:47; Interrogation_Position=723; Antisense; ATCCATTCCCGGATTCTGGGTGAAT
>probe:Drosophila_2:1638629_at:232:651; Interrogation_Position=755; Antisense; TCACGTGGACCGATACTGAGGGCTA
>probe:Drosophila_2:1638629_at:605:93; Interrogation_Position=781; Antisense; AGTTGCTCCATGATCGATGCTTGCG
>probe:Drosophila_2:1638629_at:194:699; Interrogation_Position=806; Antisense; TTTACCCGCCGGAGGACGATATGGA
>probe:Drosophila_2:1638629_at:539:729; Interrogation_Position=875; Antisense; TTGGCAATAGAGCACCCTTCGGGAT
>probe:Drosophila_2:1638629_at:143:717; Interrogation_Position=892; Antisense; TTCGGGATGTATCTGCATGCTGCGT
>probe:Drosophila_2:1638629_at:44:503; Interrogation_Position=929; Antisense; GTCGCAATTACTTTGGTGCCTTTAA
>probe:Drosophila_2:1638629_at:175:637; Interrogation_Position=963; Antisense; TAACCACCTGAACACCTATTCGGAT

Paste this into a BLAST search page for me
AAGGACTGTCCCGATTTGCCGGAGGGTCCAGTGCCACGTCCAAAAGATGTGGCGAGGAGCGCTACATGACCGTATATGACCGTATGCGACAAGTGCCCGTTGGACAATCCTCTGGGTCAGCAGCTAAGTTCAAGGATCCGGCCATGTGGCATCCATTCCCGGATTCTGGGTGAATTCACGTGGACCGATACTGAGGGCTAAGTTGCTCCATGATCGATGCTTGCGTTTACCCGCCGGAGGACGATATGGATTGGCAATAGAGCACCCTTCGGGATTTCGGGATGTATCTGCATGCTGCGTGTCGCAATTACTTTGGTGCCTTTAATAACCACCTGAACACCTATTCGGAT

Full Affymetrix probeset data:

Annotations for 1638629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720