FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638630_at:

>probe:Drosophila_2:1638630_at:233:215; Interrogation_Position=374; Antisense; AAGATCCTTTCTGTGCCAAATCTGC
>probe:Drosophila_2:1638630_at:458:215; Interrogation_Position=425; Antisense; AAGTTGGCCACCAAACTGGACGCAG
>probe:Drosophila_2:1638630_at:391:587; Interrogation_Position=441; Antisense; TGGACGCAGCCTGGTCTAAGCGACA
>probe:Drosophila_2:1638630_at:264:7; Interrogation_Position=484; Antisense; ATTGCAGGTGCTCATCCAGATCAAC
>probe:Drosophila_2:1638630_at:408:71; Interrogation_Position=540; Antisense; AGGCGAAAGATGCTCCTGCACTCTA
>probe:Drosophila_2:1638630_at:724:179; Interrogation_Position=587; Antisense; AAACACCTCAACCTGATGGGCATAA
>probe:Drosophila_2:1638630_at:513:591; Interrogation_Position=619; Antisense; TGGTGCATTTGGTTTTGACTACAGC
>probe:Drosophila_2:1638630_at:718:227; Interrogation_Position=644; Antisense; AATGGACCCAATCCGGATTTCGTGT
>probe:Drosophila_2:1638630_at:442:17; Interrogation_Position=660; Antisense; ATTTCGTGTCCCTAATGCAGGTGCA
>probe:Drosophila_2:1638630_at:73:449; Interrogation_Position=687; Antisense; GATCCATATGTGAGGCGCACTCCTT
>probe:Drosophila_2:1638630_at:348:621; Interrogation_Position=726; Antisense; TGCTCGTCTCCATGGGAATGTCCAA
>probe:Drosophila_2:1638630_at:143:597; Interrogation_Position=744; Antisense; TGTCCAACGACTTCGACAAGGCGAT
>probe:Drosophila_2:1638630_at:507:153; Interrogation_Position=782; Antisense; ACAGTGGTGCGCGTTGGCTCTTCTA
>probe:Drosophila_2:1638630_at:694:571; Interrogation_Position=797; Antisense; GGCTCTTCTATTTTCGGCCATCGGG

Paste this into a BLAST search page for me
AAGATCCTTTCTGTGCCAAATCTGCAAGTTGGCCACCAAACTGGACGCAGTGGACGCAGCCTGGTCTAAGCGACAATTGCAGGTGCTCATCCAGATCAACAGGCGAAAGATGCTCCTGCACTCTAAAACACCTCAACCTGATGGGCATAATGGTGCATTTGGTTTTGACTACAGCAATGGACCCAATCCGGATTTCGTGTATTTCGTGTCCCTAATGCAGGTGCAGATCCATATGTGAGGCGCACTCCTTTGCTCGTCTCCATGGGAATGTCCAATGTCCAACGACTTCGACAAGGCGATACAGTGGTGCGCGTTGGCTCTTCTAGGCTCTTCTATTTTCGGCCATCGGG

Full Affymetrix probeset data:

Annotations for 1638630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720