Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638633_at:

>probe:Drosophila_2:1638633_at:300:79; Interrogation_Position=1214; Antisense; AGGATTTGCTGTGCCTCGCTGAGCA
>probe:Drosophila_2:1638633_at:482:427; Interrogation_Position=1279; Antisense; GAGTTCGTTCGCAACCAATTTCAGG
>probe:Drosophila_2:1638633_at:116:231; Interrogation_Position=1305; Antisense; AATGTCCTGCAAGTGCTTCCGCAAC
>probe:Drosophila_2:1638633_at:175:443; Interrogation_Position=1381; Antisense; GATGTGTACGCAAACAACTCCTATG
>probe:Drosophila_2:1638633_at:634:193; Interrogation_Position=1396; Antisense; AACTCCTATGTGGACCTGGATGTGC
>probe:Drosophila_2:1638633_at:262:589; Interrogation_Position=1412; Antisense; TGGATGTGCACTTTCGCTTCGAGAC
>probe:Drosophila_2:1638633_at:643:411; Interrogation_Position=1434; Antisense; GACCATTATGGTCTATCGCACCAGC
>probe:Drosophila_2:1638633_at:378:639; Interrogation_Position=1463; Antisense; TCTTCGGCTGGGTGGACTTAATGGT
>probe:Drosophila_2:1638633_at:94:435; Interrogation_Position=1496; Antisense; GAGGAATTGCCGGTCTTTTTCTTGG
>probe:Drosophila_2:1638633_at:11:729; Interrogation_Position=1517; Antisense; TTGGCTGCTCCCTAATTAGTGGCAT
>probe:Drosophila_2:1638633_at:377:195; Interrogation_Position=1544; Antisense; AACTGGCCTATTTCCTGTGCATTGA
>probe:Drosophila_2:1638633_at:292:721; Interrogation_Position=1657; Antisense; TTGAACTTTCAACAAACCACGCCCA
>probe:Drosophila_2:1638633_at:211:135; Interrogation_Position=1675; Antisense; ACGCCCAGTCAGCTGATGGAGAACT
>probe:Drosophila_2:1638633_at:143:385; Interrogation_Position=1743; Antisense; GAACTTTCAAAACTGGCACCGCATA

Paste this into a BLAST search page for me
AGGATTTGCTGTGCCTCGCTGAGCAGAGTTCGTTCGCAACCAATTTCAGGAATGTCCTGCAAGTGCTTCCGCAACGATGTGTACGCAAACAACTCCTATGAACTCCTATGTGGACCTGGATGTGCTGGATGTGCACTTTCGCTTCGAGACGACCATTATGGTCTATCGCACCAGCTCTTCGGCTGGGTGGACTTAATGGTGAGGAATTGCCGGTCTTTTTCTTGGTTGGCTGCTCCCTAATTAGTGGCATAACTGGCCTATTTCCTGTGCATTGATTGAACTTTCAACAAACCACGCCCAACGCCCAGTCAGCTGATGGAGAACTGAACTTTCAAAACTGGCACCGCATA

Full Affymetrix probeset data:

Annotations for 1638633_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime