Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638634_at:

>probe:Drosophila_2:1638634_at:470:377; Interrogation_Position=104; Antisense; GAAGCACCGGAGTCTTCCGGCTGAT
>probe:Drosophila_2:1638634_at:506:719; Interrogation_Position=118; Antisense; TTCCGGCTGATCAACTTCGAGTTGT
>probe:Drosophila_2:1638634_at:630:65; Interrogation_Position=13; Antisense; ATGGCTATCTTACACAAGCATTTAG
>probe:Drosophila_2:1638634_at:606:191; Interrogation_Position=130; Antisense; AACTTCGAGTTGTACACCAAGCCGA
>probe:Drosophila_2:1638634_at:599:455; Interrogation_Position=138; Antisense; GTTGTACACCAAGCCGAACAAGATT
>probe:Drosophila_2:1638634_at:82:187; Interrogation_Position=154; Antisense; AACAAGATTATCATGGGCCTGGGAC
>probe:Drosophila_2:1638634_at:418:275; Interrogation_Position=198; Antisense; CTTCGGCTACATCGCGTATATGAGG
>probe:Drosophila_2:1638634_at:419:115; Interrogation_Position=235; Antisense; AGCTTGGGATACTATGTGGCTGTCC
>probe:Drosophila_2:1638634_at:446:653; Interrogation_Position=244; Antisense; TACTATGTGGCTGTCCAGGAGAACG
>probe:Drosophila_2:1638634_at:168:209; Interrogation_Position=28; Antisense; AAGCATTTAGTGGAGAAGACGACGA
>probe:Drosophila_2:1638634_at:104:375; Interrogation_Position=288; Antisense; GAAGAAGTCGAATTGGGAGCAGTAA
>probe:Drosophila_2:1638634_at:22:267; Interrogation_Position=73; Antisense; CAGGGTCCTGGCGATGGCATCCGAT
>probe:Drosophila_2:1638634_at:242:441; Interrogation_Position=85; Antisense; GATGGCATCCGATCCATGCGAAGCA
>probe:Drosophila_2:1638634_at:126:449; Interrogation_Position=95; Antisense; GATCCATGCGAAGCACCGGAGTCTT

Paste this into a BLAST search page for me
GAAGCACCGGAGTCTTCCGGCTGATTTCCGGCTGATCAACTTCGAGTTGTATGGCTATCTTACACAAGCATTTAGAACTTCGAGTTGTACACCAAGCCGAGTTGTACACCAAGCCGAACAAGATTAACAAGATTATCATGGGCCTGGGACCTTCGGCTACATCGCGTATATGAGGAGCTTGGGATACTATGTGGCTGTCCTACTATGTGGCTGTCCAGGAGAACGAAGCATTTAGTGGAGAAGACGACGAGAAGAAGTCGAATTGGGAGCAGTAACAGGGTCCTGGCGATGGCATCCGATGATGGCATCCGATCCATGCGAAGCAGATCCATGCGAAGCACCGGAGTCTT

Full Affymetrix probeset data:

Annotations for 1638634_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime