FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638635_at:

>probe:Drosophila_2:1638635_at:443:113; Interrogation_Position=1712; Antisense; AGCACCTCTTCCGACTAAATAACAT
>probe:Drosophila_2:1638635_at:362:651; Interrogation_Position=1737; Antisense; TCACTATATCCTCAAGTCGCTGCAA
>probe:Drosophila_2:1638635_at:481:335; Interrogation_Position=1755; Antisense; GCTGCAACGCTCCAATCTTATTGAT
>probe:Drosophila_2:1638635_at:380:5; Interrogation_Position=1774; Antisense; ATTGATTTGGTCACCTTGGCTGAGC
>probe:Drosophila_2:1638635_at:636:273; Interrogation_Position=1788; Antisense; CTTGGCTGAGCCTGAGTGCGAACAT
>probe:Drosophila_2:1638635_at:284:341; Interrogation_Position=1843; Antisense; GCTAGCTATCAAAAGACCTGGTCCA
>probe:Drosophila_2:1638635_at:400:131; Interrogation_Position=1858; Antisense; ACCTGGTCCAAGATGCTGGTCGGCA
>probe:Drosophila_2:1638635_at:218:537; Interrogation_Position=1875; Antisense; GGTCGGCATCTATTCCTTGGATGAA
>probe:Drosophila_2:1638635_at:199:547; Interrogation_Position=1893; Antisense; GGATGAACTGCCCAAACCAGTGGCC
>probe:Drosophila_2:1638635_at:613:27; Interrogation_Position=2017; Antisense; ATACCCGATGTGATCCTGCGAGAAG
>probe:Drosophila_2:1638635_at:316:63; Interrogation_Position=2057; Antisense; ATGTGGAGCACATACTGCCCATCTA
>probe:Drosophila_2:1638635_at:656:607; Interrogation_Position=2174; Antisense; TGAGCAAGCTCTTTGATGATTCGGC
>probe:Drosophila_2:1638635_at:537:99; Interrogation_Position=2201; Antisense; AGATGTTAAATGCAGGCCAGGCTTT
>probe:Drosophila_2:1638635_at:195:315; Interrogation_Position=2216; Antisense; GCCAGGCTTTAAGTGCATTCCTTGT

Paste this into a BLAST search page for me
AGCACCTCTTCCGACTAAATAACATTCACTATATCCTCAAGTCGCTGCAAGCTGCAACGCTCCAATCTTATTGATATTGATTTGGTCACCTTGGCTGAGCCTTGGCTGAGCCTGAGTGCGAACATGCTAGCTATCAAAAGACCTGGTCCAACCTGGTCCAAGATGCTGGTCGGCAGGTCGGCATCTATTCCTTGGATGAAGGATGAACTGCCCAAACCAGTGGCCATACCCGATGTGATCCTGCGAGAAGATGTGGAGCACATACTGCCCATCTATGAGCAAGCTCTTTGATGATTCGGCAGATGTTAAATGCAGGCCAGGCTTTGCCAGGCTTTAAGTGCATTCCTTGT

Full Affymetrix probeset data:

Annotations for 1638635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720