FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638636_at:

>probe:Drosophila_2:1638636_at:389:349; Interrogation_Position=1490; Antisense; GCAGTGATGTTGTCCTCAACTCAGT
>probe:Drosophila_2:1638636_at:418:727; Interrogation_Position=1514; Antisense; TTGGCCATCTGACGGATCACATCGA
>probe:Drosophila_2:1638636_at:317:597; Interrogation_Position=1569; Antisense; TGTGCCATTTGGACAGCCCGGAGAG
>probe:Drosophila_2:1638636_at:545:507; Interrogation_Position=1596; Antisense; GTGCGTCCGCGGATATACCACAATG
>probe:Drosophila_2:1638636_at:171:161; Interrogation_Position=1615; Antisense; ACAATGCTGGGCTACCACGATGATG
>probe:Drosophila_2:1638636_at:232:327; Interrogation_Position=1688; Antisense; GCGATCAGTTTGTCCTGGAGGCCAA
>probe:Drosophila_2:1638636_at:21:67; Interrogation_Position=1718; Antisense; ATGGACGGATTGTGGGTCGCCTAAA
>probe:Drosophila_2:1638636_at:370:99; Interrogation_Position=1745; Antisense; AGATGCTCATCCGTGGCGGCGAAAA
>probe:Drosophila_2:1638636_at:450:443; Interrogation_Position=1785; Antisense; GATCGAAGACTTTCTAAACGCCCAT
>probe:Drosophila_2:1638636_at:124:49; Interrogation_Position=1808; Antisense; ATCCACAGGTCATTGAGGCGCATGT
>probe:Drosophila_2:1638636_at:524:509; Interrogation_Position=1859; Antisense; GTGAAGAAGTCTGCGCCTATGTTCG
>probe:Drosophila_2:1638636_at:594:711; Interrogation_Position=1912; Antisense; TTCACCGCGGAGACCTTAAAGGCCT
>probe:Drosophila_2:1638636_at:363:223; Interrogation_Position=1963; Antisense; AAGGTGCCCAGATATGTGATCCCCA
>probe:Drosophila_2:1638636_at:144:605; Interrogation_Position=1979; Antisense; TGATCCCCATAGATGCATTCCCTAA

Paste this into a BLAST search page for me
GCAGTGATGTTGTCCTCAACTCAGTTTGGCCATCTGACGGATCACATCGATGTGCCATTTGGACAGCCCGGAGAGGTGCGTCCGCGGATATACCACAATGACAATGCTGGGCTACCACGATGATGGCGATCAGTTTGTCCTGGAGGCCAAATGGACGGATTGTGGGTCGCCTAAAAGATGCTCATCCGTGGCGGCGAAAAGATCGAAGACTTTCTAAACGCCCATATCCACAGGTCATTGAGGCGCATGTGTGAAGAAGTCTGCGCCTATGTTCGTTCACCGCGGAGACCTTAAAGGCCTAAGGTGCCCAGATATGTGATCCCCATGATCCCCATAGATGCATTCCCTAA

Full Affymetrix probeset data:

Annotations for 1638636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720