FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638638_at:

>probe:Drosophila_2:1638638_at:365:401; Interrogation_Position=1013; Antisense; GACAGGAGCTCTTCAAGCAACCGAT
>probe:Drosophila_2:1638638_at:183:459; Interrogation_Position=1035; Antisense; GATTTTCACGGTTCAGCCGGAGTTA
>probe:Drosophila_2:1638638_at:603:547; Interrogation_Position=1053; Antisense; GGAGTTACGAGTCATCCAGACCAGT
>probe:Drosophila_2:1638638_at:25:713; Interrogation_Position=1082; Antisense; TTCTATCGCTGGTCATGCAGTCGAA
>probe:Drosophila_2:1638638_at:250:449; Interrogation_Position=1137; Antisense; GATCCATCGGGTTCAGAGTGCCGGT
>probe:Drosophila_2:1638638_at:642:193; Interrogation_Position=1185; Antisense; AACTCTGCGCGAGATGATCACCATG
>probe:Drosophila_2:1638638_at:495:273; Interrogation_Position=1232; Antisense; CATTTCCATATGTTGCTTTCCGAGA
>probe:Drosophila_2:1638638_at:336:233; Interrogation_Position=703; Antisense; AATGCCACACTCTTTCTACTAGGAT
>probe:Drosophila_2:1638638_at:123:609; Interrogation_Position=734; Antisense; TGAGTACCCTATATGCAGCACATCT
>probe:Drosophila_2:1638638_at:675:667; Interrogation_Position=783; Antisense; TACATCGCAACAGATCTCCAACTTT
>probe:Drosophila_2:1638638_at:618:177; Interrogation_Position=808; Antisense; AAACAGCTTCGAGATTCTCCGGTAA
>probe:Drosophila_2:1638638_at:124:297; Interrogation_Position=882; Antisense; CCGACCCATTCGCTACATTAAGGAT
>probe:Drosophila_2:1638638_at:692:385; Interrogation_Position=957; Antisense; GAACAGATCGAATGCCTTTTCCGCT
>probe:Drosophila_2:1638638_at:26:701; Interrogation_Position=973; Antisense; TTTTCCGCTTTGACATCCGAATGGA

Paste this into a BLAST search page for me
GACAGGAGCTCTTCAAGCAACCGATGATTTTCACGGTTCAGCCGGAGTTAGGAGTTACGAGTCATCCAGACCAGTTTCTATCGCTGGTCATGCAGTCGAAGATCCATCGGGTTCAGAGTGCCGGTAACTCTGCGCGAGATGATCACCATGCATTTCCATATGTTGCTTTCCGAGAAATGCCACACTCTTTCTACTAGGATTGAGTACCCTATATGCAGCACATCTTACATCGCAACAGATCTCCAACTTTAAACAGCTTCGAGATTCTCCGGTAACCGACCCATTCGCTACATTAAGGATGAACAGATCGAATGCCTTTTCCGCTTTTTCCGCTTTGACATCCGAATGGA

Full Affymetrix probeset data:

Annotations for 1638638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720