FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638642_at:

>probe:Drosophila_2:1638642_at:286:595; Interrogation_Position=1332; Antisense; TGGGCATTCCATATCGCGTTGTTAA
>probe:Drosophila_2:1638642_at:28:287; Interrogation_Position=1347; Antisense; GCGTTGTTAACATCGTTTCCGGTGC
>probe:Drosophila_2:1638642_at:555:201; Interrogation_Position=1376; Antisense; AACCATGCTGCCTCCAAGAAGCTGG
>probe:Drosophila_2:1638642_at:307:109; Interrogation_Position=1392; Antisense; AGAAGCTGGATCTCGAGGCCTGGTT
>probe:Drosophila_2:1638642_at:375:353; Interrogation_Position=1422; Antisense; GCAGCGGCGCTTACAGGGAACTTGT
>probe:Drosophila_2:1638642_at:348:81; Interrogation_Position=1436; Antisense; AGGGAACTTGTCTCGTGCTCTAACT
>probe:Drosophila_2:1638642_at:615:619; Interrogation_Position=1451; Antisense; TGCTCTAACTGCTTGGACTACCAGG
>probe:Drosophila_2:1638642_at:24:503; Interrogation_Position=1490; Antisense; GTCCGTTTCGGCCAGACTAAGAAGA
>probe:Drosophila_2:1638642_at:85:401; Interrogation_Position=1504; Antisense; GACTAAGAAGATGAACGCCGCCGTA
>probe:Drosophila_2:1638642_at:714:319; Interrogation_Position=1520; Antisense; GCCGCCGTAGACTATGTGCACATGC
>probe:Drosophila_2:1638642_at:267:53; Interrogation_Position=1541; Antisense; ATGCTGAACGCCACGATGTGCGCAG
>probe:Drosophila_2:1638642_at:215:491; Interrogation_Position=1642; Antisense; GTACATGCCGGCGAAGTTCCAGGAT
>probe:Drosophila_2:1638642_at:231:547; Interrogation_Position=1663; Antisense; GGATGAGATTCCGTTCGTCAAGCCC
>probe:Drosophila_2:1638642_at:558:5; Interrogation_Position=1694; Antisense; ATTGATCTGGAGTTGGCCGCCGCCG

Paste this into a BLAST search page for me
TGGGCATTCCATATCGCGTTGTTAAGCGTTGTTAACATCGTTTCCGGTGCAACCATGCTGCCTCCAAGAAGCTGGAGAAGCTGGATCTCGAGGCCTGGTTGCAGCGGCGCTTACAGGGAACTTGTAGGGAACTTGTCTCGTGCTCTAACTTGCTCTAACTGCTTGGACTACCAGGGTCCGTTTCGGCCAGACTAAGAAGAGACTAAGAAGATGAACGCCGCCGTAGCCGCCGTAGACTATGTGCACATGCATGCTGAACGCCACGATGTGCGCAGGTACATGCCGGCGAAGTTCCAGGATGGATGAGATTCCGTTCGTCAAGCCCATTGATCTGGAGTTGGCCGCCGCCG

Full Affymetrix probeset data:

Annotations for 1638642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720