FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638645_at:

>probe:Drosophila_2:1638645_at:108:315; Interrogation_Position=100; Antisense; GCCTTTATGCCCTACCGTGTGAATG
>probe:Drosophila_2:1638645_at:662:489; Interrogation_Position=129; Antisense; GTACATCATGGAGGGCCTGGCCAGC
>probe:Drosophila_2:1638645_at:274:579; Interrogation_Position=13; Antisense; TGGCCCGCAGGTATCATATATGACG
>probe:Drosophila_2:1638645_at:66:291; Interrogation_Position=168; Antisense; CGTCGGCGGACTGGGATTCATTATC
>probe:Drosophila_2:1638645_at:365:621; Interrogation_Position=239; Antisense; TGCTGACCGCCATGGGATTCATTTT
>probe:Drosophila_2:1638645_at:631:459; Interrogation_Position=254; Antisense; GATTCATTTTCATCCTGGTCTCCTT
>probe:Drosophila_2:1638645_at:92:129; Interrogation_Position=283; Antisense; ACCACCTGGCTGTTCATGCGCATGA
>probe:Drosophila_2:1638645_at:465:645; Interrogation_Position=296; Antisense; TCATGCGCATGAAGCTGCCCAGCTA
>probe:Drosophila_2:1638645_at:558:283; Interrogation_Position=322; Antisense; CTGCAGCCCTAGAATCTCTACTGAA
>probe:Drosophila_2:1638645_at:215:387; Interrogation_Position=344; Antisense; GAAAAACGCTCTCTTAGTACTCTCC
>probe:Drosophila_2:1638645_at:654:703; Interrogation_Position=357; Antisense; TTAGTACTCTCCCACATTCGAATAT
>probe:Drosophila_2:1638645_at:385:491; Interrogation_Position=384; Antisense; GTAAACCGAACTGCATTCGCCAGAA
>probe:Drosophila_2:1638645_at:356:31; Interrogation_Position=509; Antisense; ATAACTGGCTGGCTTTCATCCGAAT
>probe:Drosophila_2:1638645_at:322:311; Interrogation_Position=64; Antisense; GCCACGGTGGATGAGCACGGACACT

Paste this into a BLAST search page for me
GCCTTTATGCCCTACCGTGTGAATGGTACATCATGGAGGGCCTGGCCAGCTGGCCCGCAGGTATCATATATGACGCGTCGGCGGACTGGGATTCATTATCTGCTGACCGCCATGGGATTCATTTTGATTCATTTTCATCCTGGTCTCCTTACCACCTGGCTGTTCATGCGCATGATCATGCGCATGAAGCTGCCCAGCTACTGCAGCCCTAGAATCTCTACTGAAGAAAAACGCTCTCTTAGTACTCTCCTTAGTACTCTCCCACATTCGAATATGTAAACCGAACTGCATTCGCCAGAAATAACTGGCTGGCTTTCATCCGAATGCCACGGTGGATGAGCACGGACACT

Full Affymetrix probeset data:

Annotations for 1638645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720