Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638647_at:

>probe:Drosophila_2:1638647_at:304:317; Interrogation_Position=1225; Antisense; GCCGGCCAGACCAACTGGTATGGAT
>probe:Drosophila_2:1638647_at:65:415; Interrogation_Position=1258; Antisense; GACCAGAATCTGTTGGACGCCATTG
>probe:Drosophila_2:1638647_at:240:587; Interrogation_Position=1271; Antisense; TGGACGCCATTGTGCTGGGCACGAA
>probe:Drosophila_2:1638647_at:206:295; Interrogation_Position=1292; Antisense; CGAAGAGGATCGGTCATGGCTACAC
>probe:Drosophila_2:1638647_at:52:497; Interrogation_Position=1304; Antisense; GTCATGGCTACACGATCACCAAGCA
>probe:Drosophila_2:1638647_at:648:217; Interrogation_Position=1351; Antisense; AAGTACCTGAACATCGCGCTGGAGG
>probe:Drosophila_2:1638647_at:280:81; Interrogation_Position=1373; Antisense; AGGTGTGTCCGGTATCCAACCAGGT
>probe:Drosophila_2:1638647_at:30:197; Interrogation_Position=1403; Antisense; AACTGGGATCCGACTACCGCAGTCA
>probe:Drosophila_2:1638647_at:7:629; Interrogation_Position=1434; Antisense; TGCCACGCTGATCGCCGAGAATGTG
>probe:Drosophila_2:1638647_at:42:423; Interrogation_Position=1450; Antisense; GAGAATGTGCCCATGGTGATCGCCT
>probe:Drosophila_2:1638647_at:259:53; Interrogation_Position=1514; Antisense; ATGACTTCTACATGGCCTTTCTGGG
>probe:Drosophila_2:1638647_at:458:5; Interrogation_Position=1540; Antisense; ATTGCACCCATGAATGCCGATCTGA
>probe:Drosophila_2:1638647_at:65:615; Interrogation_Position=1562; Antisense; TGAAGTTTCTCAAGCGAACCGCCAA
>probe:Drosophila_2:1638647_at:450:363; Interrogation_Position=1587; Antisense; GAATTCCATTAAGTACAGCTCGCTA

Paste this into a BLAST search page for me
GCCGGCCAGACCAACTGGTATGGATGACCAGAATCTGTTGGACGCCATTGTGGACGCCATTGTGCTGGGCACGAACGAAGAGGATCGGTCATGGCTACACGTCATGGCTACACGATCACCAAGCAAAGTACCTGAACATCGCGCTGGAGGAGGTGTGTCCGGTATCCAACCAGGTAACTGGGATCCGACTACCGCAGTCATGCCACGCTGATCGCCGAGAATGTGGAGAATGTGCCCATGGTGATCGCCTATGACTTCTACATGGCCTTTCTGGGATTGCACCCATGAATGCCGATCTGATGAAGTTTCTCAAGCGAACCGCCAAGAATTCCATTAAGTACAGCTCGCTA

Full Affymetrix probeset data:

Annotations for 1638647_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime