FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638648_at:

>probe:Drosophila_2:1638648_at:103:25; Interrogation_Position=549; Antisense; ATATGCCGCAGGAGAGCTCGGAGCA
>probe:Drosophila_2:1638648_at:549:309; Interrogation_Position=579; Antisense; CCAACTTGTACAGGGAGAATTCTCC
>probe:Drosophila_2:1638648_at:115:13; Interrogation_Position=597; Antisense; ATTCTCCGGCGGAATTGGTCACGAG
>probe:Drosophila_2:1638648_at:413:137; Interrogation_Position=617; Antisense; ACGAGAACTGTAACCACGAGCATCA
>probe:Drosophila_2:1638648_at:35:137; Interrogation_Position=632; Antisense; ACGAGCATCACAAGCATCATGGACA
>probe:Drosophila_2:1638648_at:115:223; Interrogation_Position=751; Antisense; AAGGTATAGTTATTGCTCACATTAA
>probe:Drosophila_2:1638648_at:106:665; Interrogation_Position=815; Antisense; TACAAGCACCATTACAACTTTCTAT
>probe:Drosophila_2:1638648_at:348:159; Interrogation_Position=828; Antisense; ACAACTTTCTATTGAACTTCCGCAA
>probe:Drosophila_2:1638648_at:134:385; Interrogation_Position=841; Antisense; GAACTTCCGCAATAATTATCAATCT
>probe:Drosophila_2:1638648_at:504:703; Interrogation_Position=856; Antisense; TTATCAATCTTCGATTTCCCGAACT
>probe:Drosophila_2:1638648_at:174:631; Interrogation_Position=871; Antisense; TTCCCGAACTAATCTCAGTACCAGT
>probe:Drosophila_2:1638648_at:337:91; Interrogation_Position=887; Antisense; AGTACCAGTCGATTAAAGCAACATT
>probe:Drosophila_2:1638648_at:407:397; Interrogation_Position=961; Antisense; GACACATCTATTTTATAAACCTCTG
>probe:Drosophila_2:1638648_at:81:31; Interrogation_Position=975; Antisense; ATAAACCTCTGCAAGTTATTCGAGA

Paste this into a BLAST search page for me
ATATGCCGCAGGAGAGCTCGGAGCACCAACTTGTACAGGGAGAATTCTCCATTCTCCGGCGGAATTGGTCACGAGACGAGAACTGTAACCACGAGCATCAACGAGCATCACAAGCATCATGGACAAAGGTATAGTTATTGCTCACATTAATACAAGCACCATTACAACTTTCTATACAACTTTCTATTGAACTTCCGCAAGAACTTCCGCAATAATTATCAATCTTTATCAATCTTCGATTTCCCGAACTTTCCCGAACTAATCTCAGTACCAGTAGTACCAGTCGATTAAAGCAACATTGACACATCTATTTTATAAACCTCTGATAAACCTCTGCAAGTTATTCGAGA

Full Affymetrix probeset data:

Annotations for 1638648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720