FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638649_at:

>probe:Drosophila_2:1638649_at:203:597; Interrogation_Position=1040; Antisense; TGTCCTTGTCCCAGGAGAACAATCT
>probe:Drosophila_2:1638649_at:267:81; Interrogation_Position=1070; Antisense; AGGTGAGCTACGTGACCATGTCGGA
>probe:Drosophila_2:1638649_at:579:589; Interrogation_Position=1106; Antisense; TGGTCTGCACCATCTTCATTTTCGG
>probe:Drosophila_2:1638649_at:488:277; Interrogation_Position=1149; Antisense; CTTTGTCAACACCATCTGGAGGCGA
>probe:Drosophila_2:1638649_at:101:573; Interrogation_Position=1169; Antisense; GGCGAAACAACGATCTGCAACTCAA
>probe:Drosophila_2:1638649_at:640:21; Interrogation_Position=1213; Antisense; ATAGTCAAGTCCACATTTGTCCCAC
>probe:Drosophila_2:1638649_at:564:151; Interrogation_Position=1236; Antisense; ACATCTGAAGAAACATCGGCGGCAT
>probe:Drosophila_2:1638649_at:174:457; Interrogation_Position=1276; Antisense; GATAGCACTATGAGCACCATGAGCA
>probe:Drosophila_2:1638649_at:350:57; Interrogation_Position=1294; Antisense; ATGAGCACCACCAGCATGGACAAGA
>probe:Drosophila_2:1638649_at:134:439; Interrogation_Position=1370; Antisense; GAGGCAGTCTTAGTCGCGAGGACTC
>probe:Drosophila_2:1638649_at:96:75; Interrogation_Position=1388; Antisense; AGGACTCGGCCATTAGCTTGGACGA
>probe:Drosophila_2:1638649_at:699:639; Interrogation_Position=1432; Antisense; TCGGAGTCCAGCGATTCGTCGAAGG
>probe:Drosophila_2:1638649_at:394:81; Interrogation_Position=1496; Antisense; AGGTGTCCCTGTGGATCGACCGCAA
>probe:Drosophila_2:1638649_at:24:599; Interrogation_Position=1553; Antisense; TGTTCAACGCCTTGTTTTGGACCCT

Paste this into a BLAST search page for me
TGTCCTTGTCCCAGGAGAACAATCTAGGTGAGCTACGTGACCATGTCGGATGGTCTGCACCATCTTCATTTTCGGCTTTGTCAACACCATCTGGAGGCGAGGCGAAACAACGATCTGCAACTCAAATAGTCAAGTCCACATTTGTCCCACACATCTGAAGAAACATCGGCGGCATGATAGCACTATGAGCACCATGAGCAATGAGCACCACCAGCATGGACAAGAGAGGCAGTCTTAGTCGCGAGGACTCAGGACTCGGCCATTAGCTTGGACGATCGGAGTCCAGCGATTCGTCGAAGGAGGTGTCCCTGTGGATCGACCGCAATGTTCAACGCCTTGTTTTGGACCCT

Full Affymetrix probeset data:

Annotations for 1638649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720