Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638652_at:

>probe:Drosophila_2:1638652_at:278:457; Interrogation_Position=2020; Antisense; GATATTTCGGTTGTAAGGCATCCTG
>probe:Drosophila_2:1638652_at:550:27; Interrogation_Position=2091; Antisense; ATACGCCTTGGATATGGAACCTGCT
>probe:Drosophila_2:1638652_at:364:585; Interrogation_Position=2105; Antisense; TGGAACCTGCTTTATTAGACACGAG
>probe:Drosophila_2:1638652_at:528:21; Interrogation_Position=2170; Antisense; ATATCCCGTAATTCTACAAGCACCC
>probe:Drosophila_2:1638652_at:656:353; Interrogation_Position=2189; Antisense; GCACCCGCTTTTGCGCAGATGAAAA
>probe:Drosophila_2:1638652_at:166:181; Interrogation_Position=2212; Antisense; AAAAAATGCTGGCTCGGCGACGATA
>probe:Drosophila_2:1638652_at:582:137; Interrogation_Position=2238; Antisense; ACGAGTCGAGTGTTTCACCGAGAGT
>probe:Drosophila_2:1638652_at:62:427; Interrogation_Position=2257; Antisense; GAGAGTCGAGCTCCTCAAACGATTT
>probe:Drosophila_2:1638652_at:130:707; Interrogation_Position=2304; Antisense; TTAAGGCAACAGGTGACAGGCTCAG
>probe:Drosophila_2:1638652_at:69:401; Interrogation_Position=2318; Antisense; GACAGGCTCAGGTGTAACTCAGGGA
>probe:Drosophila_2:1638652_at:447:279; Interrogation_Position=2335; Antisense; CTCAGGGAGCCCAAAGTTTATCAGC
>probe:Drosophila_2:1638652_at:28:705; Interrogation_Position=2352; Antisense; TTATCAGCTCACTTTTCGCCATGGA
>probe:Drosophila_2:1638652_at:59:725; Interrogation_Position=2397; Antisense; TTGGATGTGTAACCGATCTGGAACA
>probe:Drosophila_2:1638652_at:358:155; Interrogation_Position=2457; Antisense; ACAGCTCTCGTAGTGTTAATTCAAT

Paste this into a BLAST search page for me
GATATTTCGGTTGTAAGGCATCCTGATACGCCTTGGATATGGAACCTGCTTGGAACCTGCTTTATTAGACACGAGATATCCCGTAATTCTACAAGCACCCGCACCCGCTTTTGCGCAGATGAAAAAAAAAATGCTGGCTCGGCGACGATAACGAGTCGAGTGTTTCACCGAGAGTGAGAGTCGAGCTCCTCAAACGATTTTTAAGGCAACAGGTGACAGGCTCAGGACAGGCTCAGGTGTAACTCAGGGACTCAGGGAGCCCAAAGTTTATCAGCTTATCAGCTCACTTTTCGCCATGGATTGGATGTGTAACCGATCTGGAACAACAGCTCTCGTAGTGTTAATTCAAT

Full Affymetrix probeset data:

Annotations for 1638652_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime