Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638654_at:

>probe:Drosophila_2:1638654_at:58:419; Interrogation_Position=112; Antisense; GAGCTAGACATTGTAGTTTTCCGCA
>probe:Drosophila_2:1638654_at:611:475; Interrogation_Position=127; Antisense; GTTTTCCGCAACAATTGGGATGCCA
>probe:Drosophila_2:1638654_at:308:53; Interrogation_Position=13; Antisense; ATGAAGGTTCAGCTCGCTCTAACCT
>probe:Drosophila_2:1638654_at:321:511; Interrogation_Position=167; Antisense; GTGAGACACTTAACAAACCAGCCAT
>probe:Drosophila_2:1638654_at:119:275; Interrogation_Position=189; Antisense; CATTGAAATCAAGTGCCCCAGCGAA
>probe:Drosophila_2:1638654_at:219:87; Interrogation_Position=200; Antisense; AGTGCCCCAGCGAAACAGGATTCAT
>probe:Drosophila_2:1638654_at:144:499; Interrogation_Position=230; Antisense; GTCTCAAGAACTGCGTCAACTGGGA
>probe:Drosophila_2:1638654_at:96:551; Interrogation_Position=267; Antisense; GGAGAAACCAGTGGAGCCCCTTAGC
>probe:Drosophila_2:1638654_at:215:321; Interrogation_Position=282; Antisense; GCCCCTTAGCGAAGCGGATCAGTGA
>probe:Drosophila_2:1638654_at:614:635; Interrogation_Position=30; Antisense; TCTAACCTCCCTACTAGTGATTTCT
>probe:Drosophila_2:1638654_at:197:475; Interrogation_Position=377; Antisense; GTTACGGGTGGCTTACGCAGCAAAA
>probe:Drosophila_2:1638654_at:367:85; Interrogation_Position=45; Antisense; AGTGATTTCTTTTGGCATTGCCCTC
>probe:Drosophila_2:1638654_at:147:9; Interrogation_Position=61; Antisense; ATTGCCCTCGCCTATGATGGTGACG
>probe:Drosophila_2:1638654_at:50:559; Interrogation_Position=85; Antisense; GGACAGCCGGGTTGCAAGACCCAAG

Paste this into a BLAST search page for me
GAGCTAGACATTGTAGTTTTCCGCAGTTTTCCGCAACAATTGGGATGCCAATGAAGGTTCAGCTCGCTCTAACCTGTGAGACACTTAACAAACCAGCCATCATTGAAATCAAGTGCCCCAGCGAAAGTGCCCCAGCGAAACAGGATTCATGTCTCAAGAACTGCGTCAACTGGGAGGAGAAACCAGTGGAGCCCCTTAGCGCCCCTTAGCGAAGCGGATCAGTGATCTAACCTCCCTACTAGTGATTTCTGTTACGGGTGGCTTACGCAGCAAAAAGTGATTTCTTTTGGCATTGCCCTCATTGCCCTCGCCTATGATGGTGACGGGACAGCCGGGTTGCAAGACCCAAG

Full Affymetrix probeset data:

Annotations for 1638654_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime