Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638655_at:

>probe:Drosophila_2:1638655_at:650:235; Interrogation_Position=5668; Antisense; AATCCGGATCCAGCTACAATTGCAA
>probe:Drosophila_2:1638655_at:95:651; Interrogation_Position=5711; Antisense; TCACCACCAGCACGCAAGTAGAATC
>probe:Drosophila_2:1638655_at:624:455; Interrogation_Position=5749; Antisense; GATAGATCGCATGGCTCGCTTGAAT
>probe:Drosophila_2:1638655_at:246:407; Interrogation_Position=5803; Antisense; GACTGTCTAGGCGATGCATCCGAAA
>probe:Drosophila_2:1638655_at:568:543; Interrogation_Position=5829; Antisense; GGATAATGCAATCTCTTCTGGTTTA
>probe:Drosophila_2:1638655_at:15:117; Interrogation_Position=5868; Antisense; AGCTTCTGAAGCTCTGTTCGATTCA
>probe:Drosophila_2:1638655_at:625:469; Interrogation_Position=5883; Antisense; GTTCGATTCAGTTGAGGATCCCCTT
>probe:Drosophila_2:1638655_at:69:363; Interrogation_Position=5916; Antisense; GCAATCTGATTTTGGCGGGCTCGTA
>probe:Drosophila_2:1638655_at:234:525; Interrogation_Position=5932; Antisense; GGGCTCGTACAGTCTCTGGACATCG
>probe:Drosophila_2:1638655_at:516:315; Interrogation_Position=5956; Antisense; GCCTCAACTCAAGAACTGCTCAATG
>probe:Drosophila_2:1638655_at:187:343; Interrogation_Position=6014; Antisense; GACTAGGACCGTTTCCAAGTGCGAA
>probe:Drosophila_2:1638655_at:260:449; Interrogation_Position=6077; Antisense; GATCCGCTTCACTGGTTAATGTTTC
>probe:Drosophila_2:1638655_at:645:277; Interrogation_Position=6158; Antisense; CTATATCTGAAACTGCGGGCCTGGA
>probe:Drosophila_2:1638655_at:690:577; Interrogation_Position=6175; Antisense; GGCCTGGACACACTATCTGCAGATA

Paste this into a BLAST search page for me
AATCCGGATCCAGCTACAATTGCAATCACCACCAGCACGCAAGTAGAATCGATAGATCGCATGGCTCGCTTGAATGACTGTCTAGGCGATGCATCCGAAAGGATAATGCAATCTCTTCTGGTTTAAGCTTCTGAAGCTCTGTTCGATTCAGTTCGATTCAGTTGAGGATCCCCTTGCAATCTGATTTTGGCGGGCTCGTAGGGCTCGTACAGTCTCTGGACATCGGCCTCAACTCAAGAACTGCTCAATGGACTAGGACCGTTTCCAAGTGCGAAGATCCGCTTCACTGGTTAATGTTTCCTATATCTGAAACTGCGGGCCTGGAGGCCTGGACACACTATCTGCAGATA

Full Affymetrix probeset data:

Annotations for 1638655_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime