FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638656_at:

>probe:Drosophila_2:1638656_at:532:37; Interrogation_Position=1124; Antisense; ATCTCCTCGCTTGAATGTACTGCAC
>probe:Drosophila_2:1638656_at:562:85; Interrogation_Position=1170; Antisense; AGTGCAGCGCTCAGCGTTGGAGATT
>probe:Drosophila_2:1638656_at:54:213; Interrogation_Position=1259; Antisense; AAGAGATCCTCGTCTGTACGACTGG
>probe:Drosophila_2:1638656_at:226:357; Interrogation_Position=1309; Antisense; GCAAAGCGCTGGAGGCTCTCAAGAT
>probe:Drosophila_2:1638656_at:240:99; Interrogation_Position=1330; Antisense; AGATGCTGCCAAGTCGGGCGGATCA
>probe:Drosophila_2:1638656_at:138:111; Interrogation_Position=1359; Antisense; AGAATACGAGCAGCTGCCACGGTGT
>probe:Drosophila_2:1638656_at:509:559; Interrogation_Position=1392; Antisense; GGACAATCCTCCCAAGGAACCAGTT
>probe:Drosophila_2:1638656_at:337:563; Interrogation_Position=1407; Antisense; GGAACCAGTTGTGTGGCCACCGCAT
>probe:Drosophila_2:1638656_at:68:509; Interrogation_Position=1442; Antisense; GTGCTTGTTCCACATTCGCGATGAT
>probe:Drosophila_2:1638656_at:394:635; Interrogation_Position=1457; Antisense; TCGCGATGATCCCTGTGAGCAGTAC
>probe:Drosophila_2:1638656_at:384:641; Interrogation_Position=1484; Antisense; TCTGGCCAAGCAATATCCGGAAGTG
>probe:Drosophila_2:1638656_at:287:343; Interrogation_Position=1515; Antisense; GCATTGATGACAGAACTCGAGCGAT
>probe:Drosophila_2:1638656_at:670:365; Interrogation_Position=1565; Antisense; GAATAAACCAGCTGATCCTCGAGCT
>probe:Drosophila_2:1638656_at:292:307; Interrogation_Position=1581; Antisense; CCTCGAGCTGATCCCAGATTCTGGA

Paste this into a BLAST search page for me
ATCTCCTCGCTTGAATGTACTGCACAGTGCAGCGCTCAGCGTTGGAGATTAAGAGATCCTCGTCTGTACGACTGGGCAAAGCGCTGGAGGCTCTCAAGATAGATGCTGCCAAGTCGGGCGGATCAAGAATACGAGCAGCTGCCACGGTGTGGACAATCCTCCCAAGGAACCAGTTGGAACCAGTTGTGTGGCCACCGCATGTGCTTGTTCCACATTCGCGATGATTCGCGATGATCCCTGTGAGCAGTACTCTGGCCAAGCAATATCCGGAAGTGGCATTGATGACAGAACTCGAGCGATGAATAAACCAGCTGATCCTCGAGCTCCTCGAGCTGATCCCAGATTCTGGA

Full Affymetrix probeset data:

Annotations for 1638656_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720