FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638657_at:

>probe:Drosophila_2:1638657_at:417:603; Interrogation_Position=125; Antisense; TGTTCCTGTCCCAAAGTGCGGTGGT
>probe:Drosophila_2:1638657_at:106:297; Interrogation_Position=166; Antisense; CGCAGTTATCTATCTGGCCATATGA
>probe:Drosophila_2:1638657_at:325:649; Interrogation_Position=249; Antisense; TCAGCGACCGGAACTACGACTATAT
>probe:Drosophila_2:1638657_at:436:473; Interrogation_Position=277; Antisense; GTTCAGCTCAATTTTTGTTCGGTAC
>probe:Drosophila_2:1638657_at:729:497; Interrogation_Position=32; Antisense; GTCTTCTCGTTTTCAGTTCGCTGAT
>probe:Drosophila_2:1638657_at:666:659; Interrogation_Position=345; Antisense; TAACTATGCGCAGTTCCTGAACACC
>probe:Drosophila_2:1638657_at:221:251; Interrogation_Position=375; Antisense; CAAGTGTCCACTTAAGCCGAATTTT
>probe:Drosophila_2:1638657_at:25:319; Interrogation_Position=390; Antisense; GCCGAATTTTAACTACTCTCTGCAT
>probe:Drosophila_2:1638657_at:156:53; Interrogation_Position=436; Antisense; ATGCTGCCAGATCTACTGCCGGAGT
>probe:Drosophila_2:1638657_at:596:317; Interrogation_Position=453; Antisense; GCCGGAGTGCACTTATCGCTTGAAA
>probe:Drosophila_2:1638657_at:494:41; Interrogation_Position=520; Antisense; ATCGATGGACGATTGCTCAGCAAAC
>probe:Drosophila_2:1638657_at:584:605; Interrogation_Position=53; Antisense; TGATCAACTGCTCTTTGTGTGCCCA
>probe:Drosophila_2:1638657_at:265:507; Interrogation_Position=71; Antisense; GTGCCCATGTGGTGTTCGTCGATCA
>probe:Drosophila_2:1638657_at:579:711; Interrogation_Position=97; Antisense; TTCACCTTCACTGTCGATGATCGAG

Paste this into a BLAST search page for me
TGTTCCTGTCCCAAAGTGCGGTGGTCGCAGTTATCTATCTGGCCATATGATCAGCGACCGGAACTACGACTATATGTTCAGCTCAATTTTTGTTCGGTACGTCTTCTCGTTTTCAGTTCGCTGATTAACTATGCGCAGTTCCTGAACACCCAAGTGTCCACTTAAGCCGAATTTTGCCGAATTTTAACTACTCTCTGCATATGCTGCCAGATCTACTGCCGGAGTGCCGGAGTGCACTTATCGCTTGAAAATCGATGGACGATTGCTCAGCAAACTGATCAACTGCTCTTTGTGTGCCCAGTGCCCATGTGGTGTTCGTCGATCATTCACCTTCACTGTCGATGATCGAG

Full Affymetrix probeset data:

Annotations for 1638657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720