FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638658_at:

>probe:Drosophila_2:1638658_at:199:617; Interrogation_Position=329; Antisense; TGCACACACTGCAGAGGCATCGAGA
>probe:Drosophila_2:1638658_at:149:531; Interrogation_Position=364; Antisense; GGGTATCGCCAGGAGTTCAATAAGA
>probe:Drosophila_2:1638658_at:105:453; Interrogation_Position=387; Antisense; GATCTGCGCCAATCACACAATGCGA
>probe:Drosophila_2:1638658_at:64:487; Interrogation_Position=498; Antisense; GTACCTGAAGGAGAGCGGGCACCTC
>probe:Drosophila_2:1638658_at:163:313; Interrogation_Position=529; Antisense; GCCAGTCACTTGGTCAACGATCAGA
>probe:Drosophila_2:1638658_at:92:293; Interrogation_Position=563; Antisense; CGATTGAGACGCGTGACCATCTTCA
>probe:Drosophila_2:1638658_at:401:397; Interrogation_Position=596; Antisense; GACAAGCATTCAAGCGGCTGCAGAC
>probe:Drosophila_2:1638658_at:9:105; Interrogation_Position=617; Antisense; AGACCCGCTTTAACGATATCTCCAA
>probe:Drosophila_2:1638658_at:367:19; Interrogation_Position=632; Antisense; ATATCTCCAATCGATTCCCACTGAT
>probe:Drosophila_2:1638658_at:209:605; Interrogation_Position=653; Antisense; TGATTTCCAGTCTCATTCAGCGCAT
>probe:Drosophila_2:1638658_at:462:463; Interrogation_Position=697; Antisense; GATTCGCTGATCCTGGGAGCAGTTA
>probe:Drosophila_2:1638658_at:507:691; Interrogation_Position=720; Antisense; TATTGGCTTCTGTGTGATCTTGCTG
>probe:Drosophila_2:1638658_at:141:617; Interrogation_Position=746; Antisense; TGCTCTACGCCTTCAACTAGTGACC
>probe:Drosophila_2:1638658_at:519:115; Interrogation_Position=797; Antisense; AGCTTGCATTAAACTCCATTACAGA

Paste this into a BLAST search page for me
TGCACACACTGCAGAGGCATCGAGAGGGTATCGCCAGGAGTTCAATAAGAGATCTGCGCCAATCACACAATGCGAGTACCTGAAGGAGAGCGGGCACCTCGCCAGTCACTTGGTCAACGATCAGACGATTGAGACGCGTGACCATCTTCAGACAAGCATTCAAGCGGCTGCAGACAGACCCGCTTTAACGATATCTCCAAATATCTCCAATCGATTCCCACTGATTGATTTCCAGTCTCATTCAGCGCATGATTCGCTGATCCTGGGAGCAGTTATATTGGCTTCTGTGTGATCTTGCTGTGCTCTACGCCTTCAACTAGTGACCAGCTTGCATTAAACTCCATTACAGA

Full Affymetrix probeset data:

Annotations for 1638658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720