FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638659_at:

>probe:Drosophila_2:1638659_at:52:549; Interrogation_Position=1043; Antisense; GGAGGATTAGAATTGCCGCCACCGC
>probe:Drosophila_2:1638659_at:426:75; Interrogation_Position=1080; Antisense; AGGACGCACTAGACGCAATGGGAAA
>probe:Drosophila_2:1638659_at:156:559; Interrogation_Position=1120; Antisense; GGAAATGACGGAGCCACCAAGCTTA
>probe:Drosophila_2:1638659_at:185:539; Interrogation_Position=1268; Antisense; GGTAACCCACATTTTCACATTTCAA
>probe:Drosophila_2:1638659_at:44:169; Interrogation_Position=720; Antisense; AAATGGTCTTCTATCCGGGTCCATA
>probe:Drosophila_2:1638659_at:465:505; Interrogation_Position=738; Antisense; GTCCATATTTCGAGGCCTCCGAGAA
>probe:Drosophila_2:1638659_at:615:49; Interrogation_Position=816; Antisense; ATGCGAAGACCTTCTTCAGCTGCAA
>probe:Drosophila_2:1638659_at:167:647; Interrogation_Position=831; Antisense; TCAGCTGCAAGGTGTGGGCCCGAAA
>probe:Drosophila_2:1638659_at:707:43; Interrogation_Position=863; Antisense; ATCGACGATGACTACCAGGGCATGG
>probe:Drosophila_2:1638659_at:72:365; Interrogation_Position=888; Antisense; GAATTATCAAGTTCGCGCTGAGCAT
>probe:Drosophila_2:1638659_at:169:333; Interrogation_Position=904; Antisense; GCTGAGCATGCGCACCGATGATGAC
>probe:Drosophila_2:1638659_at:326:357; Interrogation_Position=930; Antisense; GCAATCCGGATTTCGAAAGGCCCTC
>probe:Drosophila_2:1638659_at:38:567; Interrogation_Position=964; Antisense; GGCACCCCGCGAAATAGATCTCGAA
>probe:Drosophila_2:1638659_at:526:365; Interrogation_Position=986; Antisense; GAATCCGAAGAGCTCGTTCCCGAAC

Paste this into a BLAST search page for me
GGAGGATTAGAATTGCCGCCACCGCAGGACGCACTAGACGCAATGGGAAAGGAAATGACGGAGCCACCAAGCTTAGGTAACCCACATTTTCACATTTCAAAAATGGTCTTCTATCCGGGTCCATAGTCCATATTTCGAGGCCTCCGAGAAATGCGAAGACCTTCTTCAGCTGCAATCAGCTGCAAGGTGTGGGCCCGAAAATCGACGATGACTACCAGGGCATGGGAATTATCAAGTTCGCGCTGAGCATGCTGAGCATGCGCACCGATGATGACGCAATCCGGATTTCGAAAGGCCCTCGGCACCCCGCGAAATAGATCTCGAAGAATCCGAAGAGCTCGTTCCCGAAC

Full Affymetrix probeset data:

Annotations for 1638659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720