FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638661_at:

>probe:Drosophila_2:1638661_at:546:429; Interrogation_Position=335; Antisense; GAGTTCACCCAAGTCGTCAGCAGCT
>probe:Drosophila_2:1638661_at:512:679; Interrogation_Position=367; Antisense; TAGGCAGCACGAAAGCTACCTGGCT
>probe:Drosophila_2:1638661_at:221:583; Interrogation_Position=387; Antisense; TGGCTTTGACCATCCGCAACGACAT
>probe:Drosophila_2:1638661_at:435:641; Interrogation_Position=441; Antisense; TCTCGGCTACCGTGAACAAGATCAG
>probe:Drosophila_2:1638661_at:32:525; Interrogation_Position=502; Antisense; GGGAAAGACCGCTGTTGCCTCCGGA
>probe:Drosophila_2:1638661_at:314:599; Interrogation_Position=558; Antisense; TGTCTCGCGATCTGCAGTACGTGGA
>probe:Drosophila_2:1638661_at:233:91; Interrogation_Position=573; Antisense; AGTACGTGGACCTTACCATCATCTC
>probe:Drosophila_2:1638661_at:615:173; Interrogation_Position=615; Antisense; AAACCTTCGGAAGCCTGATCGTGAC
>probe:Drosophila_2:1638661_at:644:113; Interrogation_Position=641; Antisense; AGCAGGGTCCTCTGCGTTGACACCA
>probe:Drosophila_2:1638661_at:323:275; Interrogation_Position=705; Antisense; CATTGGCTCTCGATGGTGTCCTCAT
>probe:Drosophila_2:1638661_at:563:47; Interrogation_Position=737; Antisense; ACCTCCTTTGGATCCGCTGATGGTT
>probe:Drosophila_2:1638661_at:527:607; Interrogation_Position=754; Antisense; TGATGGTTGCGAGTCTGGCGCACCA
>probe:Drosophila_2:1638661_at:524:131; Interrogation_Position=788; Antisense; ACCCGTATCACTTACTATCGCGATT
>probe:Drosophila_2:1638661_at:258:383; Interrogation_Position=821; Antisense; GAAACTTCCGGTATCTAAGTGTTGA

Paste this into a BLAST search page for me
GAGTTCACCCAAGTCGTCAGCAGCTTAGGCAGCACGAAAGCTACCTGGCTTGGCTTTGACCATCCGCAACGACATTCTCGGCTACCGTGAACAAGATCAGGGGAAAGACCGCTGTTGCCTCCGGATGTCTCGCGATCTGCAGTACGTGGAAGTACGTGGACCTTACCATCATCTCAAACCTTCGGAAGCCTGATCGTGACAGCAGGGTCCTCTGCGTTGACACCACATTGGCTCTCGATGGTGTCCTCATACCTCCTTTGGATCCGCTGATGGTTTGATGGTTGCGAGTCTGGCGCACCAACCCGTATCACTTACTATCGCGATTGAAACTTCCGGTATCTAAGTGTTGA

Full Affymetrix probeset data:

Annotations for 1638661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720