FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638663_at:

>probe:Drosophila_2:1638663_at:424:357; Interrogation_Position=1112; Antisense; GCAACTTCTTCATTAACCTTCTGGG
>probe:Drosophila_2:1638663_at:700:41; Interrogation_Position=1183; Antisense; ATCGGTGGTCTGTGCTACTATCTTT
>probe:Drosophila_2:1638663_at:356:13; Interrogation_Position=1246; Antisense; ATTCACGCGTTGCTCTACATTGTCT
>probe:Drosophila_2:1638663_at:645:5; Interrogation_Position=1264; Antisense; ATTGTCTTCATGTTGGGCTCGTGCG
>probe:Drosophila_2:1638663_at:204:213; Interrogation_Position=1300; Antisense; AAGACCTGGATCGATGTGTCCGGCA
>probe:Drosophila_2:1638663_at:553:351; Interrogation_Position=1322; Antisense; GCAGCTCAGCCAAGGATGTTGCCAA
>probe:Drosophila_2:1638663_at:559:49; Interrogation_Position=1372; Antisense; ATGCGTGGCCATCGCGAGAACTCGA
>probe:Drosophila_2:1638663_at:363:417; Interrogation_Position=1457; Antisense; GAGCTCTGTCTGTGATGGCCGACTT
>probe:Drosophila_2:1638663_at:178:487; Interrogation_Position=1502; Antisense; GTACGGGTATCCTGTTGGCTGTGAC
>probe:Drosophila_2:1638663_at:233:597; Interrogation_Position=1521; Antisense; TGTGACCATCATCTACCAATACTTT
>probe:Drosophila_2:1638663_at:206:347; Interrogation_Position=1580; Antisense; GCATGGGCACGCTGCTGTTCTAAGC
>probe:Drosophila_2:1638663_at:524:109; Interrogation_Position=1610; Antisense; AGAAGATCACCTGCGATCCAATCAG
>probe:Drosophila_2:1638663_at:85:655; Interrogation_Position=1642; Antisense; TAATACTTCATCATACTTCCCATAC
>probe:Drosophila_2:1638663_at:226:299; Interrogation_Position=1666; Antisense; CGCTCGCTCCCATTAAAACAAACTT

Paste this into a BLAST search page for me
GCAACTTCTTCATTAACCTTCTGGGATCGGTGGTCTGTGCTACTATCTTTATTCACGCGTTGCTCTACATTGTCTATTGTCTTCATGTTGGGCTCGTGCGAAGACCTGGATCGATGTGTCCGGCAGCAGCTCAGCCAAGGATGTTGCCAAATGCGTGGCCATCGCGAGAACTCGAGAGCTCTGTCTGTGATGGCCGACTTGTACGGGTATCCTGTTGGCTGTGACTGTGACCATCATCTACCAATACTTTGCATGGGCACGCTGCTGTTCTAAGCAGAAGATCACCTGCGATCCAATCAGTAATACTTCATCATACTTCCCATACCGCTCGCTCCCATTAAAACAAACTT

Full Affymetrix probeset data:

Annotations for 1638663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720