FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638665_at:

>probe:Drosophila_2:1638665_at:489:289; Interrogation_Position=3511; Antisense; CGGTCCTGCCAGCTAATGCAAATTG
>probe:Drosophila_2:1638665_at:100:421; Interrogation_Position=3608; Antisense; GAGCACACTGACTGCATGTGGTACT
>probe:Drosophila_2:1638665_at:274:269; Interrogation_Position=3622; Antisense; CATGTGGTACTGCTTTAGGCTTAGA
>probe:Drosophila_2:1638665_at:614:439; Interrogation_Position=3710; Antisense; GAGGCGAGTCCTTTTCAAATATAGA
>probe:Drosophila_2:1638665_at:607:67; Interrogation_Position=3741; Antisense; ATGGCATGTCACTTTCCTCGGAGAA
>probe:Drosophila_2:1638665_at:60:171; Interrogation_Position=3770; Antisense; AAAGTAGGCCTCAAGTGGTCGGTGC
>probe:Drosophila_2:1638665_at:551:537; Interrogation_Position=3827; Antisense; GGTCATTACGCAGTCCAAGGAGCTC
>probe:Drosophila_2:1638665_at:681:27; Interrogation_Position=3863; Antisense; ATACCCAGCTCTCAATGTTGTTGTG
>probe:Drosophila_2:1638665_at:657:477; Interrogation_Position=3888; Antisense; GTTTTTTGTTTGTAGCCGGCTGAAT
>probe:Drosophila_2:1638665_at:286:675; Interrogation_Position=3900; Antisense; TAGCCGGCTGAATTTTTTCGCCAAA
>probe:Drosophila_2:1638665_at:685:489; Interrogation_Position=3938; Antisense; GTAAAGCACAATTGATGAGCGCCAT
>probe:Drosophila_2:1638665_at:458:415; Interrogation_Position=3954; Antisense; GAGCGCCATTAGTTACACGTTATGT
>probe:Drosophila_2:1638665_at:649:13; Interrogation_Position=3999; Antisense; ATTAATCTCCAGAACACGCCGAGGC
>probe:Drosophila_2:1638665_at:588:25; Interrogation_Position=4031; Antisense; ATAGCACCACTTCGTCGTCTTAATC

Paste this into a BLAST search page for me
CGGTCCTGCCAGCTAATGCAAATTGGAGCACACTGACTGCATGTGGTACTCATGTGGTACTGCTTTAGGCTTAGAGAGGCGAGTCCTTTTCAAATATAGAATGGCATGTCACTTTCCTCGGAGAAAAAGTAGGCCTCAAGTGGTCGGTGCGGTCATTACGCAGTCCAAGGAGCTCATACCCAGCTCTCAATGTTGTTGTGGTTTTTTGTTTGTAGCCGGCTGAATTAGCCGGCTGAATTTTTTCGCCAAAGTAAAGCACAATTGATGAGCGCCATGAGCGCCATTAGTTACACGTTATGTATTAATCTCCAGAACACGCCGAGGCATAGCACCACTTCGTCGTCTTAATC

Full Affymetrix probeset data:

Annotations for 1638665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720