FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638666_at:

>probe:Drosophila_2:1638666_at:461:717; Interrogation_Position=1000; Antisense; TTCCGTCCCAGATTTGGTGTGCCAC
>probe:Drosophila_2:1638666_at:244:429; Interrogation_Position=1026; Antisense; GAGTCTGGCCAACGCTCGATTCGAG
>probe:Drosophila_2:1638666_at:286:257; Interrogation_Position=1066; Antisense; CAAATCATCGGCGACTGGCGGGTGT
>probe:Drosophila_2:1638666_at:476:121; Interrogation_Position=495; Antisense; AGCGGATGCCAGCACACGTAGACCT
>probe:Drosophila_2:1638666_at:173:699; Interrogation_Position=673; Antisense; TTTACTCCGCTTGCCGGTGGACAAG
>probe:Drosophila_2:1638666_at:544:207; Interrogation_Position=695; Antisense; AAGCTGATAGTGCTGTTCCGTCTGC
>probe:Drosophila_2:1638666_at:566:719; Interrogation_Position=710; Antisense; TTCCGTCTGCCAACGGAGTCGGAGG
>probe:Drosophila_2:1638666_at:16:445; Interrogation_Position=745; Antisense; GATGATTTGTCCACCGATGACGTGA
>probe:Drosophila_2:1638666_at:635:291; Interrogation_Position=765; Antisense; CGTGACAGATGATGACGGCGTCTCT
>probe:Drosophila_2:1638666_at:620:701; Interrogation_Position=806; Antisense; TTTTGCCCATGCCAGGAGCTCGAAC
>probe:Drosophila_2:1638666_at:333:199; Interrogation_Position=828; Antisense; AACGAGACCGCAATCCAATTCACAG
>probe:Drosophila_2:1638666_at:728:155; Interrogation_Position=849; Antisense; ACAGCCCAGGCAGCAATTTGTGGTG
>probe:Drosophila_2:1638666_at:662:437; Interrogation_Position=873; Antisense; GAGGAACACCCTGGACAGCGTGGAT
>probe:Drosophila_2:1638666_at:216:321; Interrogation_Position=907; Antisense; GCCCCTGTCAGGCAGCAGATTAAAC

Paste this into a BLAST search page for me
TTCCGTCCCAGATTTGGTGTGCCACGAGTCTGGCCAACGCTCGATTCGAGCAAATCATCGGCGACTGGCGGGTGTAGCGGATGCCAGCACACGTAGACCTTTTACTCCGCTTGCCGGTGGACAAGAAGCTGATAGTGCTGTTCCGTCTGCTTCCGTCTGCCAACGGAGTCGGAGGGATGATTTGTCCACCGATGACGTGACGTGACAGATGATGACGGCGTCTCTTTTTGCCCATGCCAGGAGCTCGAACAACGAGACCGCAATCCAATTCACAGACAGCCCAGGCAGCAATTTGTGGTGGAGGAACACCCTGGACAGCGTGGATGCCCCTGTCAGGCAGCAGATTAAAC

Full Affymetrix probeset data:

Annotations for 1638666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720