FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638669_at:

>probe:Drosophila_2:1638669_at:242:279; Interrogation_Position=1019; Antisense; CTAATAATTCCATACAACCGCGTCC
>probe:Drosophila_2:1638669_at:400:323; Interrogation_Position=1049; Antisense; GCGCAGATGAAGACTTTTCCGACTT
>probe:Drosophila_2:1638669_at:163:411; Interrogation_Position=1106; Antisense; GACCCGGCCAGGATTACGAAACTGC
>probe:Drosophila_2:1638669_at:391:417; Interrogation_Position=1142; Antisense; GAGCGCAGACAATTCAACCGATTCC
>probe:Drosophila_2:1638669_at:401:349; Interrogation_Position=1176; Antisense; GCAGTCTTCTGTGATCCAACCTATT
>probe:Drosophila_2:1638669_at:225:83; Interrogation_Position=1203; Antisense; AGGGCGAGCTCAATCTTCTGACAAT
>probe:Drosophila_2:1638669_at:461:187; Interrogation_Position=1255; Antisense; AACACCCATGATTTTCTGTCACCAG
>probe:Drosophila_2:1638669_at:202:495; Interrogation_Position=1272; Antisense; GTCACCAGAATTGAGCACAGCGCCT
>probe:Drosophila_2:1638669_at:256:585; Interrogation_Position=1296; Antisense; TGGAGCCAACCGAGATCCCAAGTCG
>probe:Drosophila_2:1638669_at:149:89; Interrogation_Position=1343; Antisense; AGTCGGTAAATCAGCGCAGTCTCTT
>probe:Drosophila_2:1638669_at:284:711; Interrogation_Position=1366; Antisense; TTCAACCTGGATCCCAAGTGTGCAG
>probe:Drosophila_2:1638669_at:81:557; Interrogation_Position=1393; Antisense; GGACTCAAGCTCATGGCAGGACGTT
>probe:Drosophila_2:1638669_at:85:437; Interrogation_Position=941; Antisense; GAGGATTCCAACAACCAGACCAGAA
>probe:Drosophila_2:1638669_at:128:425; Interrogation_Position=971; Antisense; GAGAGTTTCAACAACCAGGTCTAAA

Paste this into a BLAST search page for me
CTAATAATTCCATACAACCGCGTCCGCGCAGATGAAGACTTTTCCGACTTGACCCGGCCAGGATTACGAAACTGCGAGCGCAGACAATTCAACCGATTCCGCAGTCTTCTGTGATCCAACCTATTAGGGCGAGCTCAATCTTCTGACAATAACACCCATGATTTTCTGTCACCAGGTCACCAGAATTGAGCACAGCGCCTTGGAGCCAACCGAGATCCCAAGTCGAGTCGGTAAATCAGCGCAGTCTCTTTTCAACCTGGATCCCAAGTGTGCAGGGACTCAAGCTCATGGCAGGACGTTGAGGATTCCAACAACCAGACCAGAAGAGAGTTTCAACAACCAGGTCTAAA

Full Affymetrix probeset data:

Annotations for 1638669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720