Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638673_at:

>probe:Drosophila_2:1638673_at:574:433; Interrogation_Position=2717; Antisense; GAGGGCCAGGACATGCTCTACCAGT
>probe:Drosophila_2:1638673_at:431:185; Interrogation_Position=2756; Antisense; AACAACATTTGGGTGCTGCTGGAGC
>probe:Drosophila_2:1638673_at:121:419; Interrogation_Position=2777; Antisense; GAGCTAAAGCTGCAGCCGGGCAATC
>probe:Drosophila_2:1638673_at:569:587; Interrogation_Position=2835; Antisense; TGGAGGTGGCCAACATAATCTTCGC
>probe:Drosophila_2:1638673_at:436:45; Interrogation_Position=2876; Antisense; ATCCGTTCTCCATAAGCGTTCCATG
>probe:Drosophila_2:1638673_at:155:269; Interrogation_Position=2897; Antisense; CATGGCGCACATCCGATGGCATAGG
>probe:Drosophila_2:1638673_at:688:247; Interrogation_Position=2935; Antisense; AATTGGAGCTATCGATTTGCGTGTG
>probe:Drosophila_2:1638673_at:692:687; Interrogation_Position=3005; Antisense; TATATTGTGTATTGGCCGAATCGCC
>probe:Drosophila_2:1638673_at:621:303; Interrogation_Position=3020; Antisense; CCGAATCGCCACCTACATATATTAT
>probe:Drosophila_2:1638673_at:89:235; Interrogation_Position=3067; Antisense; AATCCAATCGGGTTCGTCGAGAGAT
>probe:Drosophila_2:1638673_at:461:655; Interrogation_Position=3103; Antisense; TAATCGGAGCTGCTTGTCACTCAGT
>probe:Drosophila_2:1638673_at:129:347; Interrogation_Position=3152; Antisense; GCATAACCGCATTCCAAAACTCTGT
>probe:Drosophila_2:1638673_at:287:181; Interrogation_Position=3167; Antisense; AAAACTCTGTAACCCCATATGTCCT
>probe:Drosophila_2:1638673_at:560:681; Interrogation_Position=3184; Antisense; TATGTCCTATGGTCGGCATCTATGT

Paste this into a BLAST search page for me
GAGGGCCAGGACATGCTCTACCAGTAACAACATTTGGGTGCTGCTGGAGCGAGCTAAAGCTGCAGCCGGGCAATCTGGAGGTGGCCAACATAATCTTCGCATCCGTTCTCCATAAGCGTTCCATGCATGGCGCACATCCGATGGCATAGGAATTGGAGCTATCGATTTGCGTGTGTATATTGTGTATTGGCCGAATCGCCCCGAATCGCCACCTACATATATTATAATCCAATCGGGTTCGTCGAGAGATTAATCGGAGCTGCTTGTCACTCAGTGCATAACCGCATTCCAAAACTCTGTAAAACTCTGTAACCCCATATGTCCTTATGTCCTATGGTCGGCATCTATGT

Full Affymetrix probeset data:

Annotations for 1638673_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime