FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638674_at:

>probe:Drosophila_2:1638674_at:17:321; Interrogation_Position=129; Antisense; GCCGCCACTGACCTGTGAAATTAGT
>probe:Drosophila_2:1638674_at:206:129; Interrogation_Position=146; Antisense; AAATTAGTCGGTTTCTGCAGGGAAG
>probe:Drosophila_2:1638674_at:410:563; Interrogation_Position=166; Antisense; GGAAGACTCGATGGACCTTCTTGGC
>probe:Drosophila_2:1638674_at:219:191; Interrogation_Position=18; Antisense; AACATTGGCAGTGTCATCGAAGGCA
>probe:Drosophila_2:1638674_at:421:273; Interrogation_Position=185; Antisense; CTTGGCCGTGGCTGACTAAGCAAAT
>probe:Drosophila_2:1638674_at:471:659; Interrogation_Position=239; Antisense; TAACTCTGCGCCGTAACAATGTTGC
>probe:Drosophila_2:1638674_at:518:161; Interrogation_Position=254; Antisense; ACAATGTTGCGGTGAGTGGTCTCAA
>probe:Drosophila_2:1638674_at:533:515; Interrogation_Position=269; Antisense; GTGGTCTCAAGGATCCAAACTTGGA
>probe:Drosophila_2:1638674_at:7:257; Interrogation_Position=284; Antisense; CAAACTTGGACAGGCACACCAGTAA
>probe:Drosophila_2:1638674_at:589:193; Interrogation_Position=332; Antisense; AACTGAAACTTTTCGCTGGCAGGCG
>probe:Drosophila_2:1638674_at:600:701; Interrogation_Position=341; Antisense; TTTTCGCTGGCAGGCGGAACGCAGT
>probe:Drosophila_2:1638674_at:212:227; Interrogation_Position=37; Antisense; AAGGCAGTGCAAAAAGTCGACATGA
>probe:Drosophila_2:1638674_at:511:187; Interrogation_Position=73; Antisense; AACACTTCAATTTCCGATGCCAATC
>probe:Drosophila_2:1638674_at:449:235; Interrogation_Position=94; Antisense; AATCAGGCGGAGATCCCTGGTCCAC

Paste this into a BLAST search page for me
GCCGCCACTGACCTGTGAAATTAGTAAATTAGTCGGTTTCTGCAGGGAAGGGAAGACTCGATGGACCTTCTTGGCAACATTGGCAGTGTCATCGAAGGCACTTGGCCGTGGCTGACTAAGCAAATTAACTCTGCGCCGTAACAATGTTGCACAATGTTGCGGTGAGTGGTCTCAAGTGGTCTCAAGGATCCAAACTTGGACAAACTTGGACAGGCACACCAGTAAAACTGAAACTTTTCGCTGGCAGGCGTTTTCGCTGGCAGGCGGAACGCAGTAAGGCAGTGCAAAAAGTCGACATGAAACACTTCAATTTCCGATGCCAATCAATCAGGCGGAGATCCCTGGTCCAC

Full Affymetrix probeset data:

Annotations for 1638674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720