FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638675_at:

>probe:Drosophila_2:1638675_at:1:247; Interrogation_Position=1100; Antisense; AATTCCACATTTCTTACGTCATACC
>probe:Drosophila_2:1638675_at:175:695; Interrogation_Position=1113; Antisense; TTACGTCATACCTGCACTAAGTAGT
>probe:Drosophila_2:1638675_at:601:491; Interrogation_Position=1195; Antisense; GTAATCAAATTTTAGCTTCCGGCGA
>probe:Drosophila_2:1638675_at:667:275; Interrogation_Position=1210; Antisense; CTTCCGGCGAGCGTGCTAATACAAA
>probe:Drosophila_2:1638675_at:690:383; Interrogation_Position=1239; Antisense; GAACTCTGGACTACTGGTTTTGATA
>probe:Drosophila_2:1638675_at:390:671; Interrogation_Position=715; Antisense; TACCGGAGCGAATCCTATAGCTACA
>probe:Drosophila_2:1638675_at:470:563; Interrogation_Position=748; Antisense; GGAAGAGGACCTCCCCAAATCGAGC
>probe:Drosophila_2:1638675_at:652:165; Interrogation_Position=764; Antisense; AAATCGAGCGGGATGTGTTCGACTC
>probe:Drosophila_2:1638675_at:322:715; Interrogation_Position=781; Antisense; TTCGACTCGCGGGATGGATTTGGAT
>probe:Drosophila_2:1638675_at:470:543; Interrogation_Position=796; Antisense; GGATTTGGATCATCTTATCGCAACT
>probe:Drosophila_2:1638675_at:52:685; Interrogation_Position=811; Antisense; TATCGCAACTTTTAACACCTTTCCT
>probe:Drosophila_2:1638675_at:536:143; Interrogation_Position=902; Antisense; ACTGACTTGTCTGTGTGTAATGTAA
>probe:Drosophila_2:1638675_at:692:35; Interrogation_Position=948; Antisense; ATCAGTTATTTTACTTTCCGCACGG
>probe:Drosophila_2:1638675_at:151:719; Interrogation_Position=963; Antisense; TTCCGCACGGTTTATTTATCAGACT

Paste this into a BLAST search page for me
AATTCCACATTTCTTACGTCATACCTTACGTCATACCTGCACTAAGTAGTGTAATCAAATTTTAGCTTCCGGCGACTTCCGGCGAGCGTGCTAATACAAAGAACTCTGGACTACTGGTTTTGATATACCGGAGCGAATCCTATAGCTACAGGAAGAGGACCTCCCCAAATCGAGCAAATCGAGCGGGATGTGTTCGACTCTTCGACTCGCGGGATGGATTTGGATGGATTTGGATCATCTTATCGCAACTTATCGCAACTTTTAACACCTTTCCTACTGACTTGTCTGTGTGTAATGTAAATCAGTTATTTTACTTTCCGCACGGTTCCGCACGGTTTATTTATCAGACT

Full Affymetrix probeset data:

Annotations for 1638675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720