Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638676_at:

>probe:Drosophila_2:1638676_at:406:299; Interrogation_Position=1061; Antisense; CGCGCAAGGAACGTGAAAAGGCTGA
>probe:Drosophila_2:1638676_at:127:395; Interrogation_Position=1130; Antisense; GAAAGGCCGGCTAGTATGCACTTAT
>probe:Drosophila_2:1638676_at:236:485; Interrogation_Position=1143; Antisense; GTATGCACTTATACTGCACTTTAAT
>probe:Drosophila_2:1638676_at:512:355; Interrogation_Position=1158; Antisense; GCACTTTAATTTACTTTGCCAGCAG
>probe:Drosophila_2:1638676_at:706:667; Interrogation_Position=1169; Antisense; TACTTTGCCAGCAGTAACAACACAA
>probe:Drosophila_2:1638676_at:353:561; Interrogation_Position=1200; Antisense; GGAAAATTCATTGATCGGGCAAATA
>probe:Drosophila_2:1638676_at:725:29; Interrogation_Position=1222; Antisense; ATACAAACATCAACACCCTGCGAAT
>probe:Drosophila_2:1638676_at:423:119; Interrogation_Position=743; Antisense; AGCTGGGCATACGTCGACGCCGTGC
>probe:Drosophila_2:1638676_at:502:411; Interrogation_Position=758; Antisense; GACGCCGTGCCAAAGAGGCCATGGA
>probe:Drosophila_2:1638676_at:124:81; Interrogation_Position=788; Antisense; AGGTGGATTTGATGCAACGCGACAT
>probe:Drosophila_2:1638676_at:629:199; Interrogation_Position=803; Antisense; AACGCGACATGGATGGCGGCATCAC
>probe:Drosophila_2:1638676_at:123:441; Interrogation_Position=814; Antisense; GATGGCGGCATCACAGACGCCGAGT
>probe:Drosophila_2:1638676_at:481:411; Interrogation_Position=829; Antisense; GACGCCGAGTTGGATGAACTACAGC
>probe:Drosophila_2:1638676_at:75:107; Interrogation_Position=890; Antisense; AGAAGGACGAACTGAAGCGGCTCGA

Paste this into a BLAST search page for me
CGCGCAAGGAACGTGAAAAGGCTGAGAAAGGCCGGCTAGTATGCACTTATGTATGCACTTATACTGCACTTTAATGCACTTTAATTTACTTTGCCAGCAGTACTTTGCCAGCAGTAACAACACAAGGAAAATTCATTGATCGGGCAAATAATACAAACATCAACACCCTGCGAATAGCTGGGCATACGTCGACGCCGTGCGACGCCGTGCCAAAGAGGCCATGGAAGGTGGATTTGATGCAACGCGACATAACGCGACATGGATGGCGGCATCACGATGGCGGCATCACAGACGCCGAGTGACGCCGAGTTGGATGAACTACAGCAGAAGGACGAACTGAAGCGGCTCGA

Full Affymetrix probeset data:

Annotations for 1638676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime