FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638677_at:

>probe:Drosophila_2:1638677_at:488:381; Interrogation_Position=115; Antisense; GAACCCGAGATCATGGACGCGGTCG
>probe:Drosophila_2:1638677_at:226:635; Interrogation_Position=137; Antisense; TCGCCGATCGGTTGGATCGCAGCGA
>probe:Drosophila_2:1638677_at:371:469; Interrogation_Position=15; Antisense; GTTGCACAGCAGCTACAATCGCGCA
>probe:Drosophila_2:1638677_at:224:419; Interrogation_Position=166; Antisense; GAGCTGAAGCGCCAGATCACAGTAA
>probe:Drosophila_2:1638677_at:713:655; Interrogation_Position=206; Antisense; TAATCTACGGCTATCTGCGAGTGAA
>probe:Drosophila_2:1638677_at:556:39; Interrogation_Position=236; Antisense; ATCGTTACTCGATAGTGCCCAGTCG
>probe:Drosophila_2:1638677_at:447:545; Interrogation_Position=264; Antisense; GGATCCGGACGAACATCGCGATCAT
>probe:Drosophila_2:1638677_at:572:43; Interrogation_Position=278; Antisense; ATCGCGATCATAACGAGCCCAGTTC
>probe:Drosophila_2:1638677_at:465:39; Interrogation_Position=346; Antisense; ATCTCGAGTGGAACCAGTGCTGCCA
>probe:Drosophila_2:1638677_at:376:267; Interrogation_Position=360; Antisense; CAGTGCTGCCATGGTTGACAACCAG
>probe:Drosophila_2:1638677_at:406:129; Interrogation_Position=380; Antisense; ACCAGGGTCGCGATGAAGAACTCAC
>probe:Drosophila_2:1638677_at:237:539; Interrogation_Position=431; Antisense; GGTTAAATGCTGAGCCGCAAGGGCA
>probe:Drosophila_2:1638677_at:157:147; Interrogation_Position=51; Antisense; ACTCATTCCGAATTTGTTTAGCAAC
>probe:Drosophila_2:1638677_at:16:359; Interrogation_Position=71; Antisense; GCAACATCCTACAGGTGATCGCCGA

Paste this into a BLAST search page for me
GAACCCGAGATCATGGACGCGGTCGTCGCCGATCGGTTGGATCGCAGCGAGTTGCACAGCAGCTACAATCGCGCAGAGCTGAAGCGCCAGATCACAGTAATAATCTACGGCTATCTGCGAGTGAAATCGTTACTCGATAGTGCCCAGTCGGGATCCGGACGAACATCGCGATCATATCGCGATCATAACGAGCCCAGTTCATCTCGAGTGGAACCAGTGCTGCCACAGTGCTGCCATGGTTGACAACCAGACCAGGGTCGCGATGAAGAACTCACGGTTAAATGCTGAGCCGCAAGGGCAACTCATTCCGAATTTGTTTAGCAACGCAACATCCTACAGGTGATCGCCGA

Full Affymetrix probeset data:

Annotations for 1638677_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720