Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638678_at:

>probe:Drosophila_2:1638678_at:501:551; Interrogation_Position=2521; Antisense; GGAGAACATGCCCTTTTGCAGTCCC
>probe:Drosophila_2:1638678_at:427:283; Interrogation_Position=2548; Antisense; CTGCGTGCGCAGCTTGATTAATTAA
>probe:Drosophila_2:1638678_at:729:567; Interrogation_Position=2573; Antisense; GGCAGCCAAGGAACCACAACAGTAT
>probe:Drosophila_2:1638678_at:480:257; Interrogation_Position=2587; Antisense; CACAACAGTATTCGCTCACACATAT
>probe:Drosophila_2:1638678_at:501:453; Interrogation_Position=2642; Antisense; GATCAAAGACACAATCATCGGATTT
>probe:Drosophila_2:1638678_at:298:269; Interrogation_Position=2657; Antisense; CATCGGATTTTTGACGGTGCACTAT
>probe:Drosophila_2:1638678_at:410:129; Interrogation_Position=2697; Antisense; ACCAGCTAGTGATCAATAGATGCCA
>probe:Drosophila_2:1638678_at:575:447; Interrogation_Position=2715; Antisense; GATGCCACAGACTCAAAGTGCCTAG
>probe:Drosophila_2:1638678_at:98:135; Interrogation_Position=2781; Antisense; ACGCCAATCAAATTACTGCTATTCA
>probe:Drosophila_2:1638678_at:315:253; Interrogation_Position=2915; Antisense; CAACCGACTAATTTGATTGGCTTTT
>probe:Drosophila_2:1638678_at:721:687; Interrogation_Position=2963; Antisense; TTTACAATTCCAACCGCTTTTGCAG
>probe:Drosophila_2:1638678_at:439:253; Interrogation_Position=2973; Antisense; CAACCGCTTTTGCAGTGCCAATAGA
>probe:Drosophila_2:1638678_at:703:349; Interrogation_Position=2984; Antisense; GCAGTGCCAATAGACCAAGTAGAGT
>probe:Drosophila_2:1638678_at:362:483; Interrogation_Position=3068; Antisense; GTATACAGGAAACGCACACTTTTAA

Paste this into a BLAST search page for me
GGAGAACATGCCCTTTTGCAGTCCCCTGCGTGCGCAGCTTGATTAATTAAGGCAGCCAAGGAACCACAACAGTATCACAACAGTATTCGCTCACACATATGATCAAAGACACAATCATCGGATTTCATCGGATTTTTGACGGTGCACTATACCAGCTAGTGATCAATAGATGCCAGATGCCACAGACTCAAAGTGCCTAGACGCCAATCAAATTACTGCTATTCACAACCGACTAATTTGATTGGCTTTTTTTACAATTCCAACCGCTTTTGCAGCAACCGCTTTTGCAGTGCCAATAGAGCAGTGCCAATAGACCAAGTAGAGTGTATACAGGAAACGCACACTTTTAA

Full Affymetrix probeset data:

Annotations for 1638678_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime