FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638679_at:

>probe:Drosophila_2:1638679_at:117:33; Interrogation_Position=147; Antisense; ATCAATTCTAGGTGACTGGCCTGCA
>probe:Drosophila_2:1638679_at:42:513; Interrogation_Position=158; Antisense; GTGACTGGCCTGCAAATGTGGATTT
>probe:Drosophila_2:1638679_at:87:405; Interrogation_Position=183; Antisense; GACTAGCGTGAAAAGGTCCCACAAG
>probe:Drosophila_2:1638679_at:601:513; Interrogation_Position=207; Antisense; GTGTTATGTGACCTGTATTTTGCAA
>probe:Drosophila_2:1638679_at:305:709; Interrogation_Position=234; Antisense; TTACAATATTGTGACCGCTTCTGGT
>probe:Drosophila_2:1638679_at:724:411; Interrogation_Position=246; Antisense; GACCGCTTCTGGTGAGATATTTCTG
>probe:Drosophila_2:1638679_at:510:459; Interrogation_Position=261; Antisense; GATATTTCTGGACAAGTACTACGAT
>probe:Drosophila_2:1638679_at:432:497; Interrogation_Position=27; Antisense; GTCTCTAAGACTTGTACCGCATCTG
>probe:Drosophila_2:1638679_at:213:489; Interrogation_Position=276; Antisense; GTACTACGATACTGGAGTCATTGAT
>probe:Drosophila_2:1638679_at:196:275; Interrogation_Position=294; Antisense; CATTGATGAATTGGCGGTGGCACCC
>probe:Drosophila_2:1638679_at:298:43; Interrogation_Position=326; Antisense; ATCGATGCCGATATGAGTTTAGAAT
>probe:Drosophila_2:1638679_at:315:265; Interrogation_Position=356; Antisense; CAGATTATTGTAGCCGAATTTTTGC
>probe:Drosophila_2:1638679_at:74:133; Interrogation_Position=42; Antisense; ACCGCATCTGGCTTGTATTATTTTT
>probe:Drosophila_2:1638679_at:570:247; Interrogation_Position=87; Antisense; AATTGCCGATTCTAACGATCCGTGC

Paste this into a BLAST search page for me
ATCAATTCTAGGTGACTGGCCTGCAGTGACTGGCCTGCAAATGTGGATTTGACTAGCGTGAAAAGGTCCCACAAGGTGTTATGTGACCTGTATTTTGCAATTACAATATTGTGACCGCTTCTGGTGACCGCTTCTGGTGAGATATTTCTGGATATTTCTGGACAAGTACTACGATGTCTCTAAGACTTGTACCGCATCTGGTACTACGATACTGGAGTCATTGATCATTGATGAATTGGCGGTGGCACCCATCGATGCCGATATGAGTTTAGAATCAGATTATTGTAGCCGAATTTTTGCACCGCATCTGGCTTGTATTATTTTTAATTGCCGATTCTAACGATCCGTGC

Full Affymetrix probeset data:

Annotations for 1638679_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720