FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638681_at:

>probe:Drosophila_2:1638681_at:641:727; Interrogation_Position=2057; Antisense; TTGGTCCACATCCACATTCGGAAAT
>probe:Drosophila_2:1638681_at:363:169; Interrogation_Position=2078; Antisense; AAATGGACACCCATCGAGCTCTGTT
>probe:Drosophila_2:1638681_at:426:659; Interrogation_Position=2136; Antisense; TAAGCGTGTTTCTACATCCCTGACT
>probe:Drosophila_2:1638681_at:461:353; Interrogation_Position=2204; Antisense; GCAGCCGACGCTCAGGTGATATTTG
>probe:Drosophila_2:1638681_at:656:487; Interrogation_Position=2228; Antisense; GTACTCGTATCTACTTAATGCCTTA
>probe:Drosophila_2:1638681_at:184:315; Interrogation_Position=2247; Antisense; GCCTTACTATGAATGCACTACGCGT
>probe:Drosophila_2:1638681_at:290:17; Interrogation_Position=2277; Antisense; ATTTACTCTTCGGATGACCAACTGC
>probe:Drosophila_2:1638681_at:294:413; Interrogation_Position=2292; Antisense; GACCAACTGCCCTTCTAGTAGAATT
>probe:Drosophila_2:1638681_at:19:151; Interrogation_Position=2323; Antisense; ACACTTTCTTGTCATCGATTTACGT
>probe:Drosophila_2:1638681_at:676:697; Interrogation_Position=2341; Antisense; TTTACGTACTTAATTCCCATGCGGC
>probe:Drosophila_2:1638681_at:75:569; Interrogation_Position=2363; Antisense; GGCAGGAGTTCTAGCCCTTATTATA
>probe:Drosophila_2:1638681_at:302:703; Interrogation_Position=2380; Antisense; TTATTATAATTCAGCCGTCCGGATC
>probe:Drosophila_2:1638681_at:479:305; Interrogation_Position=2398; Antisense; CCGGATCAGCCACCTATTATACATG
>probe:Drosophila_2:1638681_at:668:19; Interrogation_Position=2479; Antisense; ATTTGCACCGCTTCAATCGAGCATT

Paste this into a BLAST search page for me
TTGGTCCACATCCACATTCGGAAATAAATGGACACCCATCGAGCTCTGTTTAAGCGTGTTTCTACATCCCTGACTGCAGCCGACGCTCAGGTGATATTTGGTACTCGTATCTACTTAATGCCTTAGCCTTACTATGAATGCACTACGCGTATTTACTCTTCGGATGACCAACTGCGACCAACTGCCCTTCTAGTAGAATTACACTTTCTTGTCATCGATTTACGTTTTACGTACTTAATTCCCATGCGGCGGCAGGAGTTCTAGCCCTTATTATATTATTATAATTCAGCCGTCCGGATCCCGGATCAGCCACCTATTATACATGATTTGCACCGCTTCAATCGAGCATT

Full Affymetrix probeset data:

Annotations for 1638681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720