FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638685_at:

>probe:Drosophila_2:1638685_at:641:595; Interrogation_Position=104; Antisense; TGTGGTCTTATTATCTCTGTTTGGG
>probe:Drosophila_2:1638685_at:550:339; Interrogation_Position=143; Antisense; GTTTTAATGGGTCTATTCTTCTACA
>probe:Drosophila_2:1638685_at:463:29; Interrogation_Position=167; Antisense; ATAAATAGTGTAGCCCTCATTGAGG
>probe:Drosophila_2:1638685_at:34:275; Interrogation_Position=184; Antisense; CATTGAGGACTTACCTCTTGAGGAG
>probe:Drosophila_2:1638685_at:231:549; Interrogation_Position=205; Antisense; GGAGGAATACCATTCGTTGGAAGAT
>probe:Drosophila_2:1638685_at:47:467; Interrogation_Position=220; Antisense; GTTGGAAGATTTTTATGCAGCTGCA
>probe:Drosophila_2:1638685_at:553:233; Interrogation_Position=263; Antisense; AATGCCTACAACTGCTGGATTGCCG
>probe:Drosophila_2:1638685_at:114:543; Interrogation_Position=279; Antisense; GGATTGCCGCATGTATATATGTTTT
>probe:Drosophila_2:1638685_at:331:23; Interrogation_Position=295; Antisense; ATATGTTTTGACTTTGTTGCTCTCC
>probe:Drosophila_2:1638685_at:201:283; Interrogation_Position=316; Antisense; CTCCGCCCAGCAATTTTACATGAAT
>probe:Drosophila_2:1638685_at:698:21; Interrogation_Position=361; Antisense; ATATTTCAGATGTAGTTTCCCAACT
>probe:Drosophila_2:1638685_at:656:481; Interrogation_Position=397; Antisense; GTATTGAAATTTTCCCTTCGATATA
>probe:Drosophila_2:1638685_at:532:163; Interrogation_Position=72; Antisense; AAATGAAAATCTGTGGCCCGAAACT
>probe:Drosophila_2:1638685_at:676:569; Interrogation_Position=86; Antisense; GGCCCGAAACTATCACTTTGTGGTC

Paste this into a BLAST search page for me
TGTGGTCTTATTATCTCTGTTTGGGGTTTTAATGGGTCTATTCTTCTACAATAAATAGTGTAGCCCTCATTGAGGCATTGAGGACTTACCTCTTGAGGAGGGAGGAATACCATTCGTTGGAAGATGTTGGAAGATTTTTATGCAGCTGCAAATGCCTACAACTGCTGGATTGCCGGGATTGCCGCATGTATATATGTTTTATATGTTTTGACTTTGTTGCTCTCCCTCCGCCCAGCAATTTTACATGAATATATTTCAGATGTAGTTTCCCAACTGTATTGAAATTTTCCCTTCGATATAAAATGAAAATCTGTGGCCCGAAACTGGCCCGAAACTATCACTTTGTGGTC

Full Affymetrix probeset data:

Annotations for 1638685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720