FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638687_at:

>probe:Drosophila_2:1638687_at:147:383; Interrogation_Position=1005; Antisense; GAACTACTGCCTTCCAATTGGCTTT
>probe:Drosophila_2:1638687_at:540:727; Interrogation_Position=1022; Antisense; TTGGCTTTCCAAATACTCAAATGTC
>probe:Drosophila_2:1638687_at:176:363; Interrogation_Position=493; Antisense; GAATTCTTTCATGTGTTGTTTTCAG
>probe:Drosophila_2:1638687_at:363:369; Interrogation_Position=640; Antisense; GAATGCTGCAAACTTTATGTCAACT
>probe:Drosophila_2:1638687_at:325:493; Interrogation_Position=658; Antisense; GTCAACTTCTTACAGGATCAGTCCT
>probe:Drosophila_2:1638687_at:345:545; Interrogation_Position=672; Antisense; GGATCAGTCCTCTCAGATTTTTAAA
>probe:Drosophila_2:1638687_at:645:233; Interrogation_Position=695; Antisense; AATGCGCTACTGTGGATAATCTTAA
>probe:Drosophila_2:1638687_at:458:441; Interrogation_Position=730; Antisense; GATGTGTATTCCGTAACGAAGCTTA
>probe:Drosophila_2:1638687_at:706:563; Interrogation_Position=773; Antisense; GGCAACTTGAGTTTCGCATCCAACG
>probe:Drosophila_2:1638687_at:695:477; Interrogation_Position=809; Antisense; GTTTATTGTATAACAGCCCTAACAT
>probe:Drosophila_2:1638687_at:298:199; Interrogation_Position=873; Antisense; AACCTTATTTAGAAATCTCTCCGAG
>probe:Drosophila_2:1638687_at:687:37; Interrogation_Position=887; Antisense; ATCTCTCCGAGCTAGACATGTTCAT
>probe:Drosophila_2:1638687_at:105:113; Interrogation_Position=936; Antisense; AGCAGCCGCATTAAGATTTCGTCGA
>probe:Drosophila_2:1638687_at:614:551; Interrogation_Position=993; Antisense; GGAACCGAACCAGAACTACTGCCTT

Paste this into a BLAST search page for me
GAACTACTGCCTTCCAATTGGCTTTTTGGCTTTCCAAATACTCAAATGTCGAATTCTTTCATGTGTTGTTTTCAGGAATGCTGCAAACTTTATGTCAACTGTCAACTTCTTACAGGATCAGTCCTGGATCAGTCCTCTCAGATTTTTAAAAATGCGCTACTGTGGATAATCTTAAGATGTGTATTCCGTAACGAAGCTTAGGCAACTTGAGTTTCGCATCCAACGGTTTATTGTATAACAGCCCTAACATAACCTTATTTAGAAATCTCTCCGAGATCTCTCCGAGCTAGACATGTTCATAGCAGCCGCATTAAGATTTCGTCGAGGAACCGAACCAGAACTACTGCCTT

Full Affymetrix probeset data:

Annotations for 1638687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720