FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638688_at:

>probe:Drosophila_2:1638688_at:249:237; Interrogation_Position=1181; Antisense; AATCGTTCAATCAGCGTGTGGCCTT
>probe:Drosophila_2:1638688_at:409:521; Interrogation_Position=1198; Antisense; GTGGCCTTCAATATGCATGTCCGGA
>probe:Drosophila_2:1638688_at:89:61; Interrogation_Position=1214; Antisense; ATGTCCGGATTCATACCGGCGTGAA
>probe:Drosophila_2:1638688_at:205:511; Interrogation_Position=1234; Antisense; GTGAAACCCCACAAATGCAACGAGT
>probe:Drosophila_2:1638688_at:57:703; Interrogation_Position=1270; Antisense; TTTTCGCGTAAAATGCTGCTCAAAC
>probe:Drosophila_2:1638688_at:369:107; Interrogation_Position=1319; Antisense; AGAAACCGTATCAGTGCTCCGTGTG
>probe:Drosophila_2:1638688_at:235:173; Interrogation_Position=1446; Antisense; AAAGCATCACCTAAAGACGCATCTG
>probe:Drosophila_2:1638688_at:474:667; Interrogation_Position=1479; Antisense; TACAGGCTGCAAGCCGTATGTCTGC
>probe:Drosophila_2:1638688_at:151:73; Interrogation_Position=1523; Antisense; AGGCATTCACCCAGTCGAGCAATAT
>probe:Drosophila_2:1638688_at:381:107; Interrogation_Position=1562; Antisense; AGAAGTGTCAGTACCGTCCGTTGGA
>probe:Drosophila_2:1638688_at:217:725; Interrogation_Position=1582; Antisense; TTGGATGGACTCACGGTCACATCAT
>probe:Drosophila_2:1638688_at:438:269; Interrogation_Position=1659; Antisense; CATGGCCATGGCTCAAACATTTCAA
>probe:Drosophila_2:1638688_at:49:91; Interrogation_Position=1701; Antisense; AGTTCTAACACCTGGATCTGGTCCA
>probe:Drosophila_2:1638688_at:673:273; Interrogation_Position=1750; Antisense; CTTCTCAGCAATCTCAGGACATTCT

Paste this into a BLAST search page for me
AATCGTTCAATCAGCGTGTGGCCTTGTGGCCTTCAATATGCATGTCCGGAATGTCCGGATTCATACCGGCGTGAAGTGAAACCCCACAAATGCAACGAGTTTTTCGCGTAAAATGCTGCTCAAACAGAAACCGTATCAGTGCTCCGTGTGAAAGCATCACCTAAAGACGCATCTGTACAGGCTGCAAGCCGTATGTCTGCAGGCATTCACCCAGTCGAGCAATATAGAAGTGTCAGTACCGTCCGTTGGATTGGATGGACTCACGGTCACATCATCATGGCCATGGCTCAAACATTTCAAAGTTCTAACACCTGGATCTGGTCCACTTCTCAGCAATCTCAGGACATTCT

Full Affymetrix probeset data:

Annotations for 1638688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720