FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638690_at:

>probe:Drosophila_2:1638690_at:528:359; Interrogation_Position=1015; Antisense; GCAACTGTTAGCTTTTCACAACTGG
>probe:Drosophila_2:1638690_at:68:197; Interrogation_Position=1034; Antisense; AACTGGCTTTTAATGCAACTCTCAA
>probe:Drosophila_2:1638690_at:557:1; Interrogation_Position=1059; Antisense; ATACGTTACGTTCGTTACGCACTAT
>probe:Drosophila_2:1638690_at:459:597; Interrogation_Position=569; Antisense; TGTCGCTCCATTCGCATTGGAAAGA
>probe:Drosophila_2:1638690_at:454:391; Interrogation_Position=588; Antisense; GAAAGATCCTGGTCGAGTCCGATGC
>probe:Drosophila_2:1638690_at:451:113; Interrogation_Position=665; Antisense; AGCAGGCAGGTGCTACTCATGTACC
>probe:Drosophila_2:1638690_at:674:229; Interrogation_Position=728; Antisense; AATGTGCTGCGGGAACACGGCGTAC
>probe:Drosophila_2:1638690_at:349:141; Interrogation_Position=744; Antisense; ACGGCGTACCCGAGAGCTGCATCAT
>probe:Drosophila_2:1638690_at:419:7; Interrogation_Position=794; Antisense; ATTGCCGCTCGGACCGTAGTGAATG
>probe:Drosophila_2:1638690_at:650:679; Interrogation_Position=810; Antisense; TAGTGAATGCCTTCCCCAAGCTGAA
>probe:Drosophila_2:1638690_at:210:355; Interrogation_Position=863; Antisense; GCACCTAATCACTTTGGCCAGAAAT
>probe:Drosophila_2:1638690_at:217:457; Interrogation_Position=904; Antisense; GATACTTGGGTCTATCTCGCAGACT
>probe:Drosophila_2:1638690_at:207:105; Interrogation_Position=924; Antisense; AGACTTGACGACTAAGCGCTGCTTA
>probe:Drosophila_2:1638690_at:25:621; Interrogation_Position=991; Antisense; TGCGGCCAACCAAACTACTACTTAG

Paste this into a BLAST search page for me
GCAACTGTTAGCTTTTCACAACTGGAACTGGCTTTTAATGCAACTCTCAAATACGTTACGTTCGTTACGCACTATTGTCGCTCCATTCGCATTGGAAAGAGAAAGATCCTGGTCGAGTCCGATGCAGCAGGCAGGTGCTACTCATGTACCAATGTGCTGCGGGAACACGGCGTACACGGCGTACCCGAGAGCTGCATCATATTGCCGCTCGGACCGTAGTGAATGTAGTGAATGCCTTCCCCAAGCTGAAGCACCTAATCACTTTGGCCAGAAATGATACTTGGGTCTATCTCGCAGACTAGACTTGACGACTAAGCGCTGCTTATGCGGCCAACCAAACTACTACTTAG

Full Affymetrix probeset data:

Annotations for 1638690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720