FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638691_at:

>probe:Drosophila_2:1638691_at:562:575; Interrogation_Position=119; Antisense; GGCGCAATCATGACGTGGAGCTTCT
>probe:Drosophila_2:1638691_at:687:517; Interrogation_Position=133; Antisense; GTGGAGCTTCTAAAACGGCGACTAG
>probe:Drosophila_2:1638691_at:484:141; Interrogation_Position=147; Antisense; ACGGCGACTAGATAAGCACGGAGAC
>probe:Drosophila_2:1638691_at:190:659; Interrogation_Position=159; Antisense; TAAGCACGGAGACGACTGGCGATCC
>probe:Drosophila_2:1638691_at:638:581; Interrogation_Position=175; Antisense; TGGCGATCCGTTCCCATGGAGGCTC
>probe:Drosophila_2:1638691_at:146:547; Interrogation_Position=192; Antisense; GGAGGCTCCACATCCCAAAGGGAAA
>probe:Drosophila_2:1638691_at:299:379; Interrogation_Position=225; Antisense; GAAGCGTCGAGGACCGAAGCCCAAA
>probe:Drosophila_2:1638691_at:418:295; Interrogation_Position=244; Antisense; CCCAAAAACAAGCAGGCGGCGGATG
>probe:Drosophila_2:1638691_at:137:55; Interrogation_Position=266; Antisense; ATGAAACAGGAGCACCCGGGTCTGA
>probe:Drosophila_2:1638691_at:486:529; Interrogation_Position=283; Antisense; GGGTCTGAGCCTGGACCCAATACTC
>probe:Drosophila_2:1638691_at:438:183; Interrogation_Position=333; Antisense; AAAAGCCAAACAGGCACCCATCAAT
>probe:Drosophila_2:1638691_at:283:33; Interrogation_Position=352; Antisense; ATCAATCCCAATCCAGTCATTGCAC
>probe:Drosophila_2:1638691_at:399:89; Interrogation_Position=366; Antisense; AGTCATTGCACCACCGCATCAACAA
>probe:Drosophila_2:1638691_at:615:283; Interrogation_Position=37; Antisense; CTGTATGACAGGTGCCAAAGGATTC

Paste this into a BLAST search page for me
GGCGCAATCATGACGTGGAGCTTCTGTGGAGCTTCTAAAACGGCGACTAGACGGCGACTAGATAAGCACGGAGACTAAGCACGGAGACGACTGGCGATCCTGGCGATCCGTTCCCATGGAGGCTCGGAGGCTCCACATCCCAAAGGGAAAGAAGCGTCGAGGACCGAAGCCCAAACCCAAAAACAAGCAGGCGGCGGATGATGAAACAGGAGCACCCGGGTCTGAGGGTCTGAGCCTGGACCCAATACTCAAAAGCCAAACAGGCACCCATCAATATCAATCCCAATCCAGTCATTGCACAGTCATTGCACCACCGCATCAACAACTGTATGACAGGTGCCAAAGGATTC

Full Affymetrix probeset data:

Annotations for 1638691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720