Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638695_at:

>probe:Drosophila_2:1638695_at:445:197; Interrogation_Position=1645; Antisense; AACCGTCCAGTATACGACCAGCGAG
>probe:Drosophila_2:1638695_at:120:599; Interrogation_Position=1683; Antisense; TGTACCGTCTGTCCGGCGACAAGAA
>probe:Drosophila_2:1638695_at:282:621; Interrogation_Position=1803; Antisense; TGCTCGCTCAGTTTGCGGACAACAA
>probe:Drosophila_2:1638695_at:366:289; Interrogation_Position=1830; Antisense; CGGCTCTGTTCAAGGCTGTCAAAGT
>probe:Drosophila_2:1638695_at:727:103; Interrogation_Position=1884; Antisense; AGACTTTGCGCGTGGACTTGTGGAA
>probe:Drosophila_2:1638695_at:419:585; Interrogation_Position=1904; Antisense; TGGAAGCAGGGCACACGCATCAACT
>probe:Drosophila_2:1638695_at:693:189; Interrogation_Position=1925; Antisense; AACTTCCGCACCGTGGTCGTGGAGA
>probe:Drosophila_2:1638695_at:310:225; Interrogation_Position=1955; Antisense; AAGGAGGTCATATCCGGCGCCTATG
>probe:Drosophila_2:1638695_at:41:577; Interrogation_Position=1970; Antisense; GGCGCCTATGTCGACCTGAAGAGCT
>probe:Drosophila_2:1638695_at:653:375; Interrogation_Position=1987; Antisense; GAAGAGCTCACAGGCCAAGCTGTAA
>probe:Drosophila_2:1638695_at:711:123; Interrogation_Position=2011; Antisense; AGCGCGGATCACCTAGAGACACATA
>probe:Drosophila_2:1638695_at:283:399; Interrogation_Position=2028; Antisense; GACACATAGTCTGCCTTAGTCGCAA
>probe:Drosophila_2:1638695_at:607:401; Interrogation_Position=2065; Antisense; GACTTTATAATTCGTTTCGCGTCCG
>probe:Drosophila_2:1638695_at:297:53; Interrogation_Position=2131; Antisense; ATGCAATTGTTTAAACGCCCGTGGT

Paste this into a BLAST search page for me
AACCGTCCAGTATACGACCAGCGAGTGTACCGTCTGTCCGGCGACAAGAATGCTCGCTCAGTTTGCGGACAACAACGGCTCTGTTCAAGGCTGTCAAAGTAGACTTTGCGCGTGGACTTGTGGAATGGAAGCAGGGCACACGCATCAACTAACTTCCGCACCGTGGTCGTGGAGAAAGGAGGTCATATCCGGCGCCTATGGGCGCCTATGTCGACCTGAAGAGCTGAAGAGCTCACAGGCCAAGCTGTAAAGCGCGGATCACCTAGAGACACATAGACACATAGTCTGCCTTAGTCGCAAGACTTTATAATTCGTTTCGCGTCCGATGCAATTGTTTAAACGCCCGTGGT

Full Affymetrix probeset data:

Annotations for 1638695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime