FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638697_at:

>probe:Drosophila_2:1638697_at:601:45; Interrogation_Position=349; Antisense; ATGCCATCCCCGAGTTCAGGAACGA
>probe:Drosophila_2:1638697_at:96:613; Interrogation_Position=377; Antisense; TGACAGCACCTATGAGAGCTCCACG
>probe:Drosophila_2:1638697_at:443:629; Interrogation_Position=396; Antisense; TCCACGGAGCCGAGCAAGCAGTACA
>probe:Drosophila_2:1638697_at:336:491; Interrogation_Position=416; Antisense; GTACAGCTCGCTGGCTTTGATCAAC
>probe:Drosophila_2:1638697_at:412:147; Interrogation_Position=463; Antisense; ACTACAAGTGCGTGGTGCAGACCTC
>probe:Drosophila_2:1638697_at:590:607; Interrogation_Position=532; Antisense; TGAGGAACTACACCCTGGAGCTGTC
>probe:Drosophila_2:1638697_at:221:503; Interrogation_Position=554; Antisense; GTCCCACAAGACGATCCACAATGAG
>probe:Drosophila_2:1638697_at:633:117; Interrogation_Position=583; Antisense; AGCTGAACTGCACCGTGACGAACGT
>probe:Drosophila_2:1638697_at:480:511; Interrogation_Position=597; Antisense; GTGACGAACGTGTATCCCAGGCCCA
>probe:Drosophila_2:1638697_at:429:81; Interrogation_Position=688; Antisense; AGGGATACTTCGATGGCAGCGCCGT
>probe:Drosophila_2:1638697_at:514:669; Interrogation_Position=750; Antisense; TACCAGTGCGTGGTGTCCTTCGAGG
>probe:Drosophila_2:1638697_at:357:455; Interrogation_Position=775; Antisense; GATACGGCAAGAACCTGACCACGGT
>probe:Drosophila_2:1638697_at:271:571; Interrogation_Position=847; Antisense; GGCTGTTTTGTTTTCTGTACTACCT
>probe:Drosophila_2:1638697_at:257:601; Interrogation_Position=862; Antisense; TGTACTACCTGCTCTGCAAGCTGAA

Paste this into a BLAST search page for me
ATGCCATCCCCGAGTTCAGGAACGATGACAGCACCTATGAGAGCTCCACGTCCACGGAGCCGAGCAAGCAGTACAGTACAGCTCGCTGGCTTTGATCAACACTACAAGTGCGTGGTGCAGACCTCTGAGGAACTACACCCTGGAGCTGTCGTCCCACAAGACGATCCACAATGAGAGCTGAACTGCACCGTGACGAACGTGTGACGAACGTGTATCCCAGGCCCAAGGGATACTTCGATGGCAGCGCCGTTACCAGTGCGTGGTGTCCTTCGAGGGATACGGCAAGAACCTGACCACGGTGGCTGTTTTGTTTTCTGTACTACCTTGTACTACCTGCTCTGCAAGCTGAA

Full Affymetrix probeset data:

Annotations for 1638697_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720