Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638699_at:

>probe:Drosophila_2:1638699_at:185:45; Interrogation_Position=1012; Antisense; AGCCGGTTCACCACCAGGGAAACAG
>probe:Drosophila_2:1638699_at:368:115; Interrogation_Position=1048; Antisense; AGCAGGATCAGATGACCCAGCAGGA
>probe:Drosophila_2:1638699_at:640:703; Interrogation_Position=1087; Antisense; TTATCATGCGCGAGTCGGCAGTGCA
>probe:Drosophila_2:1638699_at:485:677; Interrogation_Position=1125; Antisense; TAGTCGTCCTCATTACCAATCTTCA
>probe:Drosophila_2:1638699_at:260:287; Interrogation_Position=1157; Antisense; CTGGATGCAGAACCAACGCTTGCTT
>probe:Drosophila_2:1638699_at:655:199; Interrogation_Position=1171; Antisense; AACGCTTGCTTCCAAACACCAGAAG
>probe:Drosophila_2:1638699_at:628:349; Interrogation_Position=1228; Antisense; GCAGGGCGTATGCAGCTCAACTGTA
>probe:Drosophila_2:1638699_at:689:103; Interrogation_Position=1344; Antisense; AGACTCACCTGTTCTGAAGACCGAA
>probe:Drosophila_2:1638699_at:693:55; Interrogation_Position=1361; Antisense; AGACCGAAACACACACTGGCGTTGA
>probe:Drosophila_2:1638699_at:146:647; Interrogation_Position=1390; Antisense; TCACATTCCACAAACGACGGTCAAT
>probe:Drosophila_2:1638699_at:684:13; Interrogation_Position=1424; Antisense; ATTAAGAGTCCCCAGCACGTTGATG
>probe:Drosophila_2:1638699_at:668:47; Interrogation_Position=897; Antisense; ATCCATCTGCTGAGCTACTGCAAGA
>probe:Drosophila_2:1638699_at:172:207; Interrogation_Position=945; Antisense; AAGCTGGCCTTCACGGAACTGGCGC
>probe:Drosophila_2:1638699_at:700:373; Interrogation_Position=974; Antisense; GAAGAAGGCGCCGTTGCCCAACTTT

Paste this into a BLAST search page for me
AGCCGGTTCACCACCAGGGAAACAGAGCAGGATCAGATGACCCAGCAGGATTATCATGCGCGAGTCGGCAGTGCATAGTCGTCCTCATTACCAATCTTCACTGGATGCAGAACCAACGCTTGCTTAACGCTTGCTTCCAAACACCAGAAGGCAGGGCGTATGCAGCTCAACTGTAAGACTCACCTGTTCTGAAGACCGAAAGACCGAAACACACACTGGCGTTGATCACATTCCACAAACGACGGTCAATATTAAGAGTCCCCAGCACGTTGATGATCCATCTGCTGAGCTACTGCAAGAAAGCTGGCCTTCACGGAACTGGCGCGAAGAAGGCGCCGTTGCCCAACTTT

Full Affymetrix probeset data:

Annotations for 1638699_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime