FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638700_at:

>probe:Drosophila_2:1638700_at:565:55; Interrogation_Position=7884; Antisense; ATGACATTACCTTGTGTACCTAAAG
>probe:Drosophila_2:1638700_at:67:487; Interrogation_Position=7899; Antisense; GTACCTAAAGCCCACAACCTGAAAG
>probe:Drosophila_2:1638700_at:430:469; Interrogation_Position=7930; Antisense; GTTACATATGCATATATCCACGGAT
>probe:Drosophila_2:1638700_at:183:49; Interrogation_Position=7945; Antisense; ATCCACGGATCGTTGTTGATTGATT
>probe:Drosophila_2:1638700_at:655:3; Interrogation_Position=7983; Antisense; ATTGTTGGCCCCAAGAGCTGGTCGA
>probe:Drosophila_2:1638700_at:582:345; Interrogation_Position=7997; Antisense; GAGCTGGTCGATATTTCGGGTCTTT
>probe:Drosophila_2:1638700_at:385:5; Interrogation_Position=8009; Antisense; ATTTCGGGTCTTTGATTCGGGCAAG
>probe:Drosophila_2:1638700_at:516:247; Interrogation_Position=8045; Antisense; AATTCCATTGCAGATCGGTTTGTGA
>probe:Drosophila_2:1638700_at:698:477; Interrogation_Position=8172; Antisense; GTTTAGTTCAATTCTTTCGCAATGG
>probe:Drosophila_2:1638700_at:534:695; Interrogation_Position=8186; Antisense; TTTCGCAATGGGACTTGCTGTCGGG
>probe:Drosophila_2:1638700_at:258:463; Interrogation_Position=8220; Antisense; GATTCTGAAGCTTAGAACCAGGTCA
>probe:Drosophila_2:1638700_at:241:495; Interrogation_Position=8241; Antisense; GTCAAGGCATTTACTTTCGAAGAGA
>probe:Drosophila_2:1638700_at:534:247; Interrogation_Position=8268; Antisense; AATTGCTGGCATACACGATTTTGAT
>probe:Drosophila_2:1638700_at:451:487; Interrogation_Position=8303; Antisense; GTAGCTTTGCAAACACTTCATTTCT

Paste this into a BLAST search page for me
ATGACATTACCTTGTGTACCTAAAGGTACCTAAAGCCCACAACCTGAAAGGTTACATATGCATATATCCACGGATATCCACGGATCGTTGTTGATTGATTATTGTTGGCCCCAAGAGCTGGTCGAGAGCTGGTCGATATTTCGGGTCTTTATTTCGGGTCTTTGATTCGGGCAAGAATTCCATTGCAGATCGGTTTGTGAGTTTAGTTCAATTCTTTCGCAATGGTTTCGCAATGGGACTTGCTGTCGGGGATTCTGAAGCTTAGAACCAGGTCAGTCAAGGCATTTACTTTCGAAGAGAAATTGCTGGCATACACGATTTTGATGTAGCTTTGCAAACACTTCATTTCT

Full Affymetrix probeset data:

Annotations for 1638700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720