Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638701_at:

>probe:Drosophila_2:1638701_at:105:401; Interrogation_Position=1045; Antisense; GACAGCAGCGTGCAGTTTACAGCAT
>probe:Drosophila_2:1638701_at:55:119; Interrogation_Position=1094; Antisense; AGCTAAAGGCCTGCCAGTGCAGCGA
>probe:Drosophila_2:1638701_at:639:261; Interrogation_Position=1122; Antisense; CAGCTCGACTCCTGTCAAGAAGGTT
>probe:Drosophila_2:1638701_at:471:217; Interrogation_Position=1166; Antisense; AAGTTCACGTAATGCTCGCCTGGGA
>probe:Drosophila_2:1638701_at:507:557; Interrogation_Position=1188; Antisense; GGACTACGCTTATCGGGCTGCCAGA
>probe:Drosophila_2:1638701_at:312:295; Interrogation_Position=1237; Antisense; CGAGATCGGGATCGCTTTCAGCAGC
>probe:Drosophila_2:1638701_at:177:543; Interrogation_Position=1262; Antisense; GGATTCGGCGGATTTCACCCATTCT
>probe:Drosophila_2:1638701_at:72:611; Interrogation_Position=1298; Antisense; TGACTCCAGTTCACCGAGATCGTGT
>probe:Drosophila_2:1638701_at:388:427; Interrogation_Position=1313; Antisense; GAGATCGTGTCTACCAAGCTCGATT
>probe:Drosophila_2:1638701_at:230:13; Interrogation_Position=1335; Antisense; ATTCTTGCACGAGGACTAGCTGGTC
>probe:Drosophila_2:1638701_at:706:673; Interrogation_Position=1351; Antisense; TAGCTGGTCCGCATACCTGAAGTAA
>probe:Drosophila_2:1638701_at:510:705; Interrogation_Position=1453; Antisense; TTAGCCACTGCGTTCGTGATTGATT
>probe:Drosophila_2:1638701_at:405:651; Interrogation_Position=1514; Antisense; TCAAAACCACGTACACTTTTCTTCG
>probe:Drosophila_2:1638701_at:300:643; Interrogation_Position=1533; Antisense; TCTTCGCCTTTAGTTTTAGAGCCCT

Paste this into a BLAST search page for me
GACAGCAGCGTGCAGTTTACAGCATAGCTAAAGGCCTGCCAGTGCAGCGACAGCTCGACTCCTGTCAAGAAGGTTAAGTTCACGTAATGCTCGCCTGGGAGGACTACGCTTATCGGGCTGCCAGACGAGATCGGGATCGCTTTCAGCAGCGGATTCGGCGGATTTCACCCATTCTTGACTCCAGTTCACCGAGATCGTGTGAGATCGTGTCTACCAAGCTCGATTATTCTTGCACGAGGACTAGCTGGTCTAGCTGGTCCGCATACCTGAAGTAATTAGCCACTGCGTTCGTGATTGATTTCAAAACCACGTACACTTTTCTTCGTCTTCGCCTTTAGTTTTAGAGCCCT

Full Affymetrix probeset data:

Annotations for 1638701_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime