FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638704_at:

>probe:Drosophila_2:1638704_at:630:385; Interrogation_Position=3135; Antisense; GAAAGGTCCTAACCCGAATCGATTG
>probe:Drosophila_2:1638704_at:578:13; Interrogation_Position=3167; Antisense; ATTAAGATGCTTCTGCCGATTGCCC
>probe:Drosophila_2:1638704_at:160:491; Interrogation_Position=3202; Antisense; GTACATGTTTAGTCACTCTGCCTAT
>probe:Drosophila_2:1638704_at:107:89; Interrogation_Position=3212; Antisense; AGTCACTCTGCCTATTAACGACCTT
>probe:Drosophila_2:1638704_at:642:659; Interrogation_Position=3227; Antisense; TAACGACCTTCTGCTTGGATTTATT
>probe:Drosophila_2:1638704_at:665:21; Interrogation_Position=3282; Antisense; ATATATACGACACCTTTCACGCTTG
>probe:Drosophila_2:1638704_at:242:157; Interrogation_Position=3291; Antisense; ACACCTTTCACGCTTGTTAGTCAAA
>probe:Drosophila_2:1638704_at:474:703; Interrogation_Position=3330; Antisense; TTAGCGACGCGGCAACTTTGTACTC
>probe:Drosophila_2:1638704_at:213:195; Interrogation_Position=3373; Antisense; AACGGCGCACAGACACTGGTTAGTT
>probe:Drosophila_2:1638704_at:235:219; Interrogation_Position=3477; Antisense; AAGTGCGATGTATGGCTTAGCTTCC
>probe:Drosophila_2:1638704_at:605:675; Interrogation_Position=3494; Antisense; TAGCTTCCACTTTGGTTGTTCGCAA
>probe:Drosophila_2:1638704_at:521:541; Interrogation_Position=3507; Antisense; GGTTGTTCGCAACGCAATTACTGTG
>probe:Drosophila_2:1638704_at:697:13; Interrogation_Position=3523; Antisense; ATTACTGTGCAATAATCTCTCACTT
>probe:Drosophila_2:1638704_at:405:199; Interrogation_Position=3672; Antisense; AACGCCGACATAATGAAACGCCGAA

Paste this into a BLAST search page for me
GAAAGGTCCTAACCCGAATCGATTGATTAAGATGCTTCTGCCGATTGCCCGTACATGTTTAGTCACTCTGCCTATAGTCACTCTGCCTATTAACGACCTTTAACGACCTTCTGCTTGGATTTATTATATATACGACACCTTTCACGCTTGACACCTTTCACGCTTGTTAGTCAAATTAGCGACGCGGCAACTTTGTACTCAACGGCGCACAGACACTGGTTAGTTAAGTGCGATGTATGGCTTAGCTTCCTAGCTTCCACTTTGGTTGTTCGCAAGGTTGTTCGCAACGCAATTACTGTGATTACTGTGCAATAATCTCTCACTTAACGCCGACATAATGAAACGCCGAA

Full Affymetrix probeset data:

Annotations for 1638704_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720