Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638705_at:

>probe:Drosophila_2:1638705_at:649:675; Interrogation_Position=110; Antisense; TAGCACTGGAGCTTCAGGAGCAGCC
>probe:Drosophila_2:1638705_at:575:419; Interrogation_Position=127; Antisense; GAGCAGCCGGACAAGTTGGCCTATT
>probe:Drosophila_2:1638705_at:303:691; Interrogation_Position=148; Antisense; TATTGTCGTTCGCTTCAGCAACAGA
>probe:Drosophila_2:1638705_at:83:113; Interrogation_Position=164; Antisense; AGCAACAGAAGCTGCGAATACCGCT
>probe:Drosophila_2:1638705_at:375:363; Interrogation_Position=179; Antisense; GAATACCGCTCCAAAACACTGGATG
>probe:Drosophila_2:1638705_at:213:287; Interrogation_Position=197; Antisense; CTGGATGTGCCACCATTCTGAGCAA
>probe:Drosophila_2:1638705_at:726:121; Interrogation_Position=21; Antisense; AGCGACCACAATTGCCATCGGATTG
>probe:Drosophila_2:1638705_at:577:203; Interrogation_Position=220; Antisense; AACCAGCTCGGCGTGACAGGTGAAA
>probe:Drosophila_2:1638705_at:695:399; Interrogation_Position=234; Antisense; GACAGGTGAAATGCTACTCGAGATT
>probe:Drosophila_2:1638705_at:175:463; Interrogation_Position=255; Antisense; GATTCAAAAGCGTTGCTGGGCCGGA
>probe:Drosophila_2:1638705_at:463:631; Interrogation_Position=287; Antisense; TCCTGGCAGGACGATGTCGCAAGTT
>probe:Drosophila_2:1638705_at:670:655; Interrogation_Position=47; Antisense; TAATGTTCATCCCACTGATCCTGAT
>probe:Drosophila_2:1638705_at:429:285; Interrogation_Position=67; Antisense; CTGATGCAGCTGGACCCTCAAATAG
>probe:Drosophila_2:1638705_at:185:143; Interrogation_Position=95; Antisense; ACTGGTCGGCTCAAATAGCACTGGA

Paste this into a BLAST search page for me
TAGCACTGGAGCTTCAGGAGCAGCCGAGCAGCCGGACAAGTTGGCCTATTTATTGTCGTTCGCTTCAGCAACAGAAGCAACAGAAGCTGCGAATACCGCTGAATACCGCTCCAAAACACTGGATGCTGGATGTGCCACCATTCTGAGCAAAGCGACCACAATTGCCATCGGATTGAACCAGCTCGGCGTGACAGGTGAAAGACAGGTGAAATGCTACTCGAGATTGATTCAAAAGCGTTGCTGGGCCGGATCCTGGCAGGACGATGTCGCAAGTTTAATGTTCATCCCACTGATCCTGATCTGATGCAGCTGGACCCTCAAATAGACTGGTCGGCTCAAATAGCACTGGA

Full Affymetrix probeset data:

Annotations for 1638705_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime