FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638710_at:

>probe:Drosophila_2:1638710_at:35:725; Interrogation_Position=1024; Antisense; TTGTGGCATGCAGACTAGTTTGGTT
>probe:Drosophila_2:1638710_at:672:475; Interrogation_Position=1070; Antisense; GTATGTTGTACTTGTAACGCCACCC
>probe:Drosophila_2:1638710_at:35:599; Interrogation_Position=1103; Antisense; TGTCCACAAACAGCCAATCCATAGA
>probe:Drosophila_2:1638710_at:699:293; Interrogation_Position=1149; Antisense; CGAGCGGATCTATCAATTTCCATTA
>probe:Drosophila_2:1638710_at:288:17; Interrogation_Position=1164; Antisense; ATTTCCATTACGCTATTCCTCAAAA
>probe:Drosophila_2:1638710_at:187:197; Interrogation_Position=1221; Antisense; AACGGTGTGAATTGCTCTTCTATGT
>probe:Drosophila_2:1638710_at:67:277; Interrogation_Position=1237; Antisense; CTTCTATGTGGGTATGCGATCGCGC
>probe:Drosophila_2:1638710_at:320:647; Interrogation_Position=1280; Antisense; TCAGTGCCCTTCATCAGGATTTGGT
>probe:Drosophila_2:1638710_at:61:335; Interrogation_Position=1311; Antisense; GCTGTCGAAATGGATTGCCCACCAG
>probe:Drosophila_2:1638710_at:146:655; Interrogation_Position=1406; Antisense; TACGTTATGTTTGTCAGGTTCCCCA
>probe:Drosophila_2:1638710_at:709:247; Interrogation_Position=1432; Antisense; AATTGGTGGCACTGTCTCGATGTCG
>probe:Drosophila_2:1638710_at:594:103; Interrogation_Position=895; Antisense; AGACGCAATCTTGCCAAGCGCTTGC
>probe:Drosophila_2:1638710_at:569:701; Interrogation_Position=962; Antisense; TTTTCCCTACTATTCCCATTTATTG
>probe:Drosophila_2:1638710_at:278:699; Interrogation_Position=980; Antisense; TTTATTGCAGATACTCAGCCAGGAT

Paste this into a BLAST search page for me
TTGTGGCATGCAGACTAGTTTGGTTGTATGTTGTACTTGTAACGCCACCCTGTCCACAAACAGCCAATCCATAGACGAGCGGATCTATCAATTTCCATTAATTTCCATTACGCTATTCCTCAAAAAACGGTGTGAATTGCTCTTCTATGTCTTCTATGTGGGTATGCGATCGCGCTCAGTGCCCTTCATCAGGATTTGGTGCTGTCGAAATGGATTGCCCACCAGTACGTTATGTTTGTCAGGTTCCCCAAATTGGTGGCACTGTCTCGATGTCGAGACGCAATCTTGCCAAGCGCTTGCTTTTCCCTACTATTCCCATTTATTGTTTATTGCAGATACTCAGCCAGGAT

Full Affymetrix probeset data:

Annotations for 1638710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720