FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638711_at:

>probe:Drosophila_2:1638711_at:409:339; Interrogation_Position=1364; Antisense; GCTCACGGGATGACATTGGGCGCAA
>probe:Drosophila_2:1638711_at:659:677; Interrogation_Position=1427; Antisense; TAGGCAATCCCAAGACCCTGGAGTT
>probe:Drosophila_2:1638711_at:530:549; Interrogation_Position=1446; Antisense; GGAGTTCCAAGTAGTGCGCACGACC
>probe:Drosophila_2:1638711_at:399:499; Interrogation_Position=1481; Antisense; GTCTCCTCAAGACGCTGGTGGCCAA
>probe:Drosophila_2:1638711_at:156:533; Interrogation_Position=1497; Antisense; GGTGGCCAATCGCAAGATGCCGCTA
>probe:Drosophila_2:1638711_at:85:95; Interrogation_Position=1622; Antisense; AGACCGCTGGTTTCGAGGTGGTTCA
>probe:Drosophila_2:1638711_at:382:589; Interrogation_Position=1640; Antisense; TGGTTCACGGCCTGCTAGATCGCGT
>probe:Drosophila_2:1638711_at:79:679; Interrogation_Position=1655; Antisense; TAGATCGCGTGATGCAATTGCTCTC
>probe:Drosophila_2:1638711_at:342:247; Interrogation_Position=1670; Antisense; AATTGCTCTCTGTGCCCTGGAAATC
>probe:Drosophila_2:1638711_at:588:125; Interrogation_Position=1705; Antisense; ACCAAGGGCTATTACCTTCAGGCCA
>probe:Drosophila_2:1638711_at:67:303; Interrogation_Position=1750; Antisense; CCCGGTCGCTGTGCTAATGTAATGT
>probe:Drosophila_2:1638711_at:93:599; Interrogation_Position=1772; Antisense; TGTACGACGGTGTTGTCATCGGCAA
>probe:Drosophila_2:1638711_at:248:155; Interrogation_Position=1816; Antisense; ACAGTGCTGCAAGCCTTCGAGCTGA
>probe:Drosophila_2:1638711_at:224:649; Interrogation_Position=1865; Antisense; TCACCATTGAGCCTTTCGTCTAAAA

Paste this into a BLAST search page for me
GCTCACGGGATGACATTGGGCGCAATAGGCAATCCCAAGACCCTGGAGTTGGAGTTCCAAGTAGTGCGCACGACCGTCTCCTCAAGACGCTGGTGGCCAAGGTGGCCAATCGCAAGATGCCGCTAAGACCGCTGGTTTCGAGGTGGTTCATGGTTCACGGCCTGCTAGATCGCGTTAGATCGCGTGATGCAATTGCTCTCAATTGCTCTCTGTGCCCTGGAAATCACCAAGGGCTATTACCTTCAGGCCACCCGGTCGCTGTGCTAATGTAATGTTGTACGACGGTGTTGTCATCGGCAAACAGTGCTGCAAGCCTTCGAGCTGATCACCATTGAGCCTTTCGTCTAAAA

Full Affymetrix probeset data:

Annotations for 1638711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720