FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638712_at:

>probe:Drosophila_2:1638712_at:499:343; Interrogation_Position=107; Antisense; GCTTCTTTGTTGATCGTTGCCGAGG
>probe:Drosophila_2:1638712_at:78:625; Interrogation_Position=124; Antisense; TGCCGAGGGCGTGTTTGTAGCCACA
>probe:Drosophila_2:1638712_at:336:57; Interrogation_Position=13; Antisense; ATGATCTACTCGGACAATTGCTGTT
>probe:Drosophila_2:1638712_at:235:599; Interrogation_Position=139; Antisense; TGTAGCCACAGAGGGCATCATGAAT
>probe:Drosophila_2:1638712_at:211:475; Interrogation_Position=173; Antisense; GTTTTCGATATTCTTCAATCCCGTT
>probe:Drosophila_2:1638712_at:468:249; Interrogation_Position=188; Antisense; CAATCCCGTTCTAGGCTTGTACTTT
>probe:Drosophila_2:1638712_at:369:721; Interrogation_Position=204; Antisense; TTGTACTTTTGGCTGGTGGTCTACT
>probe:Drosophila_2:1638712_at:444:519; Interrogation_Position=219; Antisense; GTGGTCTACTCCTATTATGATCGCT
>probe:Drosophila_2:1638712_at:173:683; Interrogation_Position=234; Antisense; TATGATCGCTTAAAGGACGCGTGAG
>probe:Drosophila_2:1638712_at:648:7; Interrogation_Position=29; Antisense; ATTGCTGTTGCTGCGTGGATCTGAA
>probe:Drosophila_2:1638712_at:10:41; Interrogation_Position=47; Antisense; ATCTGAAGTGCGGAAGCATCCTGAT
>probe:Drosophila_2:1638712_at:137:377; Interrogation_Position=59; Antisense; GAAGCATCCTGATAGCCATCGTTGA
>probe:Drosophila_2:1638712_at:39:125; Interrogation_Position=72; Antisense; AGCCATCGTTGAGGTGCTAATACGT
>probe:Drosophila_2:1638712_at:460:669; Interrogation_Position=92; Antisense; TACGTGGACTAGATCGCTTCTTTGT

Paste this into a BLAST search page for me
GCTTCTTTGTTGATCGTTGCCGAGGTGCCGAGGGCGTGTTTGTAGCCACAATGATCTACTCGGACAATTGCTGTTTGTAGCCACAGAGGGCATCATGAATGTTTTCGATATTCTTCAATCCCGTTCAATCCCGTTCTAGGCTTGTACTTTTTGTACTTTTGGCTGGTGGTCTACTGTGGTCTACTCCTATTATGATCGCTTATGATCGCTTAAAGGACGCGTGAGATTGCTGTTGCTGCGTGGATCTGAAATCTGAAGTGCGGAAGCATCCTGATGAAGCATCCTGATAGCCATCGTTGAAGCCATCGTTGAGGTGCTAATACGTTACGTGGACTAGATCGCTTCTTTGT

Full Affymetrix probeset data:

Annotations for 1638712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720